Labshake search
Citations for Roche :
651 - 699 of 699 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... HEK-293T and MEF cells (except for p62 KO MEF cells) were transfected with plasmids using X-tremeGENE 9 (Roche) as described as previously (41–43) ...
-
bioRxiv - Cell Biology 2024Quote: ... RPE1 cells were transfected with PB-Tet-LAP-MAP3K1 and PB-Transposase plasmid (kindly provided by N. Dimitrova) using X-tremeGENE9 reagent (Roche) and after 48 hours cells were selected with G418 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected with 1 µg of shRNA/cDNA and 1 µg of viral packaging plasmids (250 ng pMD2.G and 750 ng psPAX2) using 6 µl of Xtreme Gene 9 transfection reagent (Roche). After 24 hours of transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reaction was stopped by the addition of 500 ng of plasmid (size > 10 kb) and 0.1 pmol of ATP-γ-S tetralithium salt (10102342001-Roche, Sigma) followed by incubation for 30 min at 30°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5% CO2 for 24 h before transfection with a 4:1 DNA ratio of pCMV6-Affimer-tGFP and FLAG-ERK plasmids using Lipofectamine 2000 (SW620, HEK293, NCI-H460) or X-tremeGENE 9 (Roche; Panc10.05). After 24 h cells were serum starved for 1 h ...
-
bioRxiv - Biochemistry 2022Quote: Transfection of plasmid DNA was conducted in 293T cells using Lipofectamine 3000 (Life Technology) and X-tremeGENE™ HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... transient transfection was performed with a total of 1 µg of plasmids (EGFRmCitrine, PTBmCherry and cCblBF P at ratio 4:3:4 by mass) using FUGENE6 (Roche Diagnostics) transfection reagent and Opti-MEM (Gibco - Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid was transfected into Neuro2a cells and clonal lines selected by incubation with Hygromycin (300 mg/ml, Roche (Nutley, NJ)) ...
-
bioRxiv - Microbiology 2021Quote: ... in 6 well plates were transfected with HSIV-vif plasmids using Fugene 6 or X-tremeGENE 9 DNA transfection reagent (Roche/Sigma). At 48 hour post-transfection ...
-
bioRxiv - Biochemistry 2021Quote: Transfection of plasmid DNA was conducted in 293T cells using Lipofectamine 3000 (Life Technology) and X-tremeGENE™ HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 pseudotyped virus was generated by co-transfection of the pCAGGS-S with the viral packaging plasmid psPAX2 and pLenti-EGFP/luciferase-expressing plasmid as a proportion of 1:1:1 into HEK293T cells using the X-tremeGENE HP DNA transfection reagent (Roche, 06366546001) according to the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... cells transfected with a combination of RCAS plasmids (RCAS PDGFB-HA, RCAS shp53-RFP) using the FuGENE 6 transfection kit (Roche, 11814443001) according to the manufacturer’s protocol and as previously described 86 ...
-
bioRxiv - Microbiology 2022Quote: ... The resultant plasmids were transfected into cultured cells susceptible to the original viruses using X-tremeGENE™ HP DNA transfection reagent (Roche). For BmNPV ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mg of plasmid DNA was transfected into HMEC P5 was transduced into Phoenix packaging cells using Fugene (Roche, Basel, Switzerland). Viral supernatant was harvested 48 h after transfection ...
-
bioRxiv - Biochemistry 2022Quote: Plasmids were constructed using standard molecular biology techniques of PCR and Golden Gate assembly with Kapa HiFi DNA Polymerase (KAPA Biosystems), restriction enzymes (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... IFNγ-R2-eGFP plasmid was transfected in HeLa or Caco-2 cells with X-tremeGENE HP DNA transfection reagent (Roche, 6366236001) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: A DIG-labeled antisense probe against goosecoid (gsc) was generated by in vitro transcription from a linearized plasmid using 10x Transcription buffer (Roche, #11465384001), 10x DIG RNA labelling mix (Roche ...
-
bioRxiv - Bioengineering 2022Quote: siRNAs and plasmids were transfected using DharmaFECT 1 transfection reagent (Dharmacon T-2001) and X-tremeGENE9 DNA transfection reagent (Roche 06365809001) respectively ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR standard curves were determined using linearized plasmids as DNA templates and run on a Light Cycler 480 system (Roche Diagnostics) in duplicates ...
-
bioRxiv - Cancer Biology 2023Quote: ... This plasmid was digested with PacI and transfected into HEK293 cells using X-tremeGENETM HP DNA transfection reagent (Roche, Basel, Switzerland) to produce infectious viral particles ...
-
bioRxiv - Molecular Biology 2023Quote: Antisense and sense digoxigenin- and biotin-labeled riboprobes of AcerOr11 were synthesized using linearized pGEMHE plasmids containing appropriate insertion sequences as a template using the DIG and Biotin RNA Labeling Mix (Roche, Germany) and T7 RNA Polymerase (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed on six-well plates or confocal dishes for different purposes with plasmids using X-tremeGENE HP DNA Transfection Reagent (Roche, 6366236001) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Plasmid was cut and antisense probe was synthesized by in vitro transcription with Dig RNA Labeling Mix (Roche, Cat. No. 11277073910) or Fluorescein RNA labeling mix (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... BHK cells were transfected with 3 μg of pBAC-SARS-COV-2 construct and1 μg of SARS-CoV-2 N (Delta) plasmid with the X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 ...
-
bioRxiv - Cell Biology 2024Quote: ... and a sgRNA preceded by a rrk1 leader and followed by a Hammerhead Ribozyme as described in [17] was digested and prepared for gap repair as follows: the vector pJB166 was purified from DH5α bacterial cells using the Genopure plasmid midi kit (Roche, 03143414001) and diluted to 1 μg/μL ...
-
bioRxiv - Genomics 2019Quote: ... trachomatis molecular diagnosis was performed by using a dual-target (chromosome plus plasmid) commercial nucleic acid amplification test (NAAT) (Cobas® 4800 CT/NG from Roche Diagnostics) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The riboprobes were obtained by rub-off transcriptions of linearized pBlueScript plasmids containing the full retrozymes in the presence of DIG-UTP (Roche Diagnostic GmbH) (26).
-
bioRxiv - Immunology 2021Quote: ... NGS libraries were generated following a two-step primer extension protocol.70 30 μg of plasmid DNA were amplified using Kapa Hifi HotStart Ready mix (Kapa Biosystems, KK2602) in a 50 μl reaction using primers EpMap_7 and EpMap_8 (which bound to regions that were ~70 bp away from the peptide encoding region ...
-
bioRxiv - Epidemiology 2020Quote: ... plasmids or DNA samples (Table 1) by real-time TaqMan PCRs assays on a LightCycler® 480 (LC480) (Roche Applied Science, Germany). Real-time PCR assays were performed with LightCycler® 480 Probe Master Mix 1× (Roche Applied Science ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-sense riboprobes against target genes were synthesized from 5 µg linearized plasmids using digoxigenin-(DIG) or fluorescein-labeled uridylyltransferase (UTP) (#11685619910, #11277073910, Roche, Mannheim, Germany) and the MAXIscript in vitro Transcription Kit (#AM1312 ...
-
bioRxiv - Developmental Biology 2021Quote: Digoxigenin-labelled sense and antisense RNA probes were prepared by in vitro transcriptions using recombinant plasmids of target genes made as mentioned above (Roche Life Science) and used for in situ hybridization ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were transfected into HeLa cells growing on 100 mm dishes using X-treme GENE HP DNA transfection reagent (Roche, Laval, QC) according to manufacturer’s protocols and processed for TEM at 18 hours post transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... we performed a mutagenesis PCR using the primers [Phos]ATCGATTACAAGGATGACGATGACAAGGGTGGTGGTGGTAGTATGAAGCTACTGTCT TCTATCGAA and [Phos]GTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTCCATTTTGAAGTGGCCTGAA GTAAAGGA and the validation plasmid as template (25 μl KAPA HiFi HotStart ReadyMix (KAPA Biosystems KK2602), 1 μl 100 μM forward primer ...
-
bioRxiv - Microbiology 2022Quote: ... then guide sequences were amplified from gDNA and the plasmid pool by nested PCR using KAPA HIFI Hotstart PCR kit (Kapa Biosystems, KK2501), as previously described in (Young et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-cells were transfected with 1 µg Trop-2-pEYFP-N1 or Trop-2-Q118E-pEYFP-N1 plasmids using X-tremeGENE 9 DNA transfection reagent (Roche, Basel, Switzerland) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... the plasmid DNA was linearized by SalI digestion and transcribed by T7 RNA polymerase using Digoxigenin (Dig) RNA Labeling Mix (Roche Diagnostics, Germany) for 2 h at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cDNA inserts of the plasmids were isolated and amplified by low-cycle (12x) PCR using a Kapa2G Robust Hotstart PCR kit (Roche, Ref #07961073001) according to specifications ...
-
bioRxiv - Immunology 2024Quote: 293T cells were co-transfected with plasmids encoding cognate heavy and light chains using the Xtreme Gene 9 DNA transfection reagent (Roche, Basel, Switzerland), then grown in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Antisense riboprobes against target genes were synthesized from 5 μg linearized plasmids using digoxigenin-(DIG) or fluorescein-labeled uridylyltransferase (UTP) (#11685619910, #11277073910, Roche, Mannheim, Germany) and the MAXIscript in vitro Transcription Kit (#AM1312 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... We induced transient expression of the plasmids in 106 cells resuspended in 2 ml using the polymer X-tremeGENE 9 DNA Transfection Reagent (Roche Applied Sciences 06365787001) following manufacturer’s instructions (1 μg total DNA and 3 μl reagent in 100 μl FBS-free culture medium) ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µg of a WEAU gp160 plasmid (pcDNA3.1-WEAU gp160) into exponentially dividing 293T/17 cells using FuGENE 6 (Roche Applied Science, Indianapolis, IN) or into 293F cells using 293fectin (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... All transfections were performed with cells in exponential growth using either X-tremeGENE siRNA (for siRNA) and X-tremeGENE HP DNA (for plasmids) (Roche, Indianapolis, IN, USA).
-
bioRxiv - Developmental Biology 2022Quote: ... Digoxygenin-labeled sense and antisense probes were synthesized from the linearized plasmids using the DIG RNA Labeling Kit (SP6/T7) (Roche/MilliporeSigma, Burlington, MA). Whole-mount ISH was performed as previously described (Yan et al. ...
-
bioRxiv - Genetics 2023Quote: ... 1 µL of each primer Oligo 90 and Oligo 91 were combined with 50 ng of sample plasmid DNA and 25 µL Kapa Hifi Hotstart ReadyMix (Kapa Biosystems Cat# KK2602), and topped off with water to a total volume of 50 µL ...
-
bioRxiv - Immunology 2021Quote: ... Viral copies/ml of peripheral blood was calculated using the standard curve generated with serially diluted cloned DNA standard plasmids (Roche Molecular System, Pleasanton, CA).
-
bioRxiv - Microbiology 2020Quote: ... with plasmids containing the viral genome (described in (Sutherland et al., 2018)) using X-tremeGENE™ HP DNA Transfection Reagent (Roche, Indianapolis, IN, USA). Supernatants were applied to RAW264.7 cells (ATCC ...
-
bioRxiv - Developmental Biology 2020Quote: ... Riboprobes were synthesized from the plasmids by in vitro transcription using either T7 or Sp6 polymerase and a digoxigenin (DIG) labeling kit (Roche Applied Science, Indianapolis, IN). The primer sequences used for riboprobe preparation are given in Supplemental Table 1.
-
bioRxiv - Genetics 2022Quote: ... The hygromycin cassette including the B-tubulin promoter and terminator was amplified from pPHT1 plasmid with the KAPA HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, MA, USA). The PCR thermocycling profile used was as follows ...
-
bioRxiv - Microbiology 2023Quote: ... ZAP KO HEK293T cells were transfected with equal amounts of the transposase plasmid and an ePB transposon vector containing WT or mutant ZAP using X-tremeGENE9 DNA Transfection Reagent (Roche Life Science, Basel, Switzerland) in Opti-MEM (Thermo Fisher Scientific ...