Labshake search
Citations for Roche :
601 - 650 of 837 citations for Mouse IRX6 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: Antisense and sense digoxigenin- and biotin-labeled riboprobes of AcerOr11 were synthesized using linearized pGEMHE plasmids containing appropriate insertion sequences as a template using the DIG and Biotin RNA Labeling Mix (Roche, Germany) and T7 RNA Polymerase (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed on six-well plates or confocal dishes for different purposes with plasmids using X-tremeGENE HP DNA Transfection Reagent (Roche, 6366236001) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Plasmid was cut and antisense probe was synthesized by in vitro transcription with Dig RNA Labeling Mix (Roche, Cat. No. 11277073910) or Fluorescein RNA labeling mix (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... BHK cells were transfected with 3 μg of pBAC-SARS-COV-2 construct and1 μg of SARS-CoV-2 N (Delta) plasmid with the X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 ...
-
bioRxiv - Cell Biology 2024Quote: ... and a sgRNA preceded by a rrk1 leader and followed by a Hammerhead Ribozyme as described in [17] was digested and prepared for gap repair as follows: the vector pJB166 was purified from DH5α bacterial cells using the Genopure plasmid midi kit (Roche, 03143414001) and diluted to 1 μg/μL ...
-
bioRxiv - Molecular Biology 2019Quote: ... Expression of reporter from input was detected by mouse anti-GFP IgG (Roche, cat#11814460001), followed by a 1:5000 dilution of goat anti-mouse IgG-HRP secondary antibody (cwbiotech ...
-
bioRxiv - Immunology 2019Quote: Total protein was isolated by homogenizing mouse feces in PBS with protease inhibitor cocktail (Roche). Samples were rotated at 4°C for 4 hours and centrifuged at 16,000g for 15 minutes ...
-
bioRxiv - Cell Biology 2021Quote: The following primary antibodies were used: anti-GFP mouse monoclonal at 1:250 (Roche, 11814460001), Alexa-647 conjugated HRP polyclonal at 1:500 (Jackson) ...
-
bioRxiv - Biochemistry 2020Quote: ... Mouse monoclonal antibody raised against hemagglutinin (HA) tag (clone 12CA5, #11583816001) was obtained from Roche. Mouse monoclonal antibody raised against MYC tag (9B11 ...
-
bioRxiv - Microbiology 2020Quote: ... Infected mice were genotyped after experiments using the KAPA HotStart Mouse Genotyping Kit (KAPA Biosystems) and primers for the floxed IFNAR1 allele and the Lyve1-Cre gene from the Jackson Laboratory website.
-
bioRxiv - Molecular Biology 2021Quote: ... The primary antibodies used were anti-GFP from mouse (1:500 dilution, Roche, CAT# 11814460001) and anti-COXIV from rabbit (1:250 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The primary antibodies used were anti-GFP from mouse (1:500 dilution, Roche, CAT# 11814460001) and an endogenous compartment marker antibody from rabbit (refer to Supplementary Table 21 for list of antibodies used) ...
-
bioRxiv - Cell Biology 2022Quote: ... For analysis of TopBP1-YFP-AID mouse anti-GFP monoclonal (1:500, Cat#11814460001, Roche) and anti-mouse (IRDye® 800CW Goat anti-Mouse IgG ...
-
bioRxiv - Microbiology 2020Quote: ... The isotype of antibodies was determined using the IsoStrip Mouse Monoclonal Antibody Isotyping Kit (Roche).
-
bioRxiv - Genomics 2019Quote: ... The GFP and Pgk1 were detected using mouse anti-GFP (11 814 460 001, Roche) with the SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific ...
-
bioRxiv - Genetics 2019Quote: ... Chromatin extracts were incubated with 4uL of the following antibodies monoclonal mouse anti-MYC (Roche), monoclonal mouse anti-FLAG (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were analysed by SDS-PAGE followed by western blotting with mouse anti-GFP (Roche) and rabbit anti-α-tubulin antibodies (Abcam).
-
bioRxiv - Developmental Biology 2019Quote: ... col-LCRM-moeGFP embryos were immunostained with a primary mouse anti-GFP (1/500) (Roche) and secondary biotinylated goat anti-mouse (1/2000 ...
-
bioRxiv - Cell Biology 2020Quote: The following primary antibodies were used: anti-GFP mouse monoclonal at 1:250 (Roche, 11814460001), anti-Cnn Rabbit polyclonal raised against first 660aa of Cnn-P1 (which includes amino acids 35-632 of Cnn-P2 ...
-
bioRxiv - Cell Biology 2020Quote: ... The anti-GFP mouse monoclonal antibody mix (ref. 11814460001, 1:1000) was obtained from Roche. The rabbit anti-PKCζ (ref ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies used were: mouse monoclonal (mixture of clones 7.1 and 13.1) anti-GFP (Roche), 1:500 ...
-
bioRxiv - Genetics 2021Quote: Samples of cDNA prepared from mouse tissues were analyzed either with a LightCycler instrument (Roche) with glass capillaries ...
-
bioRxiv - Biochemistry 2021Quote: ... Primary antibodies used in this study include mouse αGFP (1:1000, 0.4 mg/ml, Roche), rabbit αGFP (1:500 ...
-
bioRxiv - Biochemistry 2021Quote: ... Primary antibodies used in this study were mouse αGFP (1:2000, 0.4 mg/ml Roche), rabbit αREX1-repeat (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse sterna and ribs from P3 neonates were cleaned and digested by pronase (Roche, 11459643001) at 2 mg/ml PBS at 37°C with constant agitation for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... and incubated with a mouse monoclonal anti-GFP antibody (Roche, 11 814 460 001, RRID:AB_390913), and anti-cdc2 (PSTAIR) ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-tagged proteins were detected using mouse anti-GFP antibody (Roche 1814460, 1:1000 dilution) and anti-mouse-HRP antibody (Amersham ...
-
bioRxiv - Genetics 2022Quote: ... Mouse exome libraries were constructed using the KAPA HyperPrep Kit (Roche Sequencing and Life Science) and SureSelect XT Community Design Mouse All Exon v2 Target Enrichment System (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2022Quote: ... and immunoprecipitated with 5 μg Mouse monoclonal anti-GFP antibody (clone 9E10, IgG, Roche, Switzerland). About 200∼300 bp of ChIP DNA and input DNA were recovered and dissolved in water for further qPCR analysis [82] ...
-
bioRxiv - Neuroscience 2022Quote: ... All genotyping experiments were performed using the KAPA Hotstart Mouse Genotyping Kit (KAPA Biosystems, KK7352) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Ultrathin sections (∼100 nm) were labelled using mouse anti-GFP antiserum (1:300, Roche 11814460001) and 18 nm Colloidal Gold AffiniPure Goat Anti-Mouse (Jackson ...
-
bioRxiv - Cell Biology 2023Quote: ... washed and probed with antibodies against the GFP-epitope (dilution 1:2500, mouse, Roche 181446001), α-Tubulin (dilution 1:10000 ...
-
bioRxiv - Plant Biology 2023Quote: ... proteins of inputs were analyzed by Western Blot with the Anti-GFP from mouse (Roche) and Monoclonal ANTI-FALG® M2 antibody produced in mouse (Sigma Aldrich).
-
bioRxiv - Biochemistry 2023Quote: ... the nitrocellulose membrane was incubated with mouse anti-GFP antibodies (1∶1000, Roche Molecular Biochemicals) and rabbit anti-mKate2 antibodies (1:2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was extracted from tail tissue using the KAPA Mouse Genotyping Kit (KAPA Biosystems, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Western blot was stained with the following primary antibodies: mouse anti-GFP antibody (11814460001, Roche) and rabbit anti-HA antibody (H6908 ...
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was blotted with anti-GFP monoclonal primary antibody (mouse monoclonal, Sigma- Roche #11814460001) at 4°C overnight ...
-
bioRxiv - Genomics 2019Quote: ... trachomatis molecular diagnosis was performed by using a dual-target (chromosome plus plasmid) commercial nucleic acid amplification test (NAAT) (Cobas® 4800 CT/NG from Roche Diagnostics) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The riboprobes were obtained by rub-off transcriptions of linearized pBlueScript plasmids containing the full retrozymes in the presence of DIG-UTP (Roche Diagnostic GmbH) (26).
-
bioRxiv - Immunology 2021Quote: ... NGS libraries were generated following a two-step primer extension protocol.70 30 μg of plasmid DNA were amplified using Kapa Hifi HotStart Ready mix (Kapa Biosystems, KK2602) in a 50 μl reaction using primers EpMap_7 and EpMap_8 (which bound to regions that were ~70 bp away from the peptide encoding region ...
-
bioRxiv - Epidemiology 2020Quote: ... plasmids or DNA samples (Table 1) by real-time TaqMan PCRs assays on a LightCycler® 480 (LC480) (Roche Applied Science, Germany). Real-time PCR assays were performed with LightCycler® 480 Probe Master Mix 1× (Roche Applied Science ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-sense riboprobes against target genes were synthesized from 5 µg linearized plasmids using digoxigenin-(DIG) or fluorescein-labeled uridylyltransferase (UTP) (#11685619910, #11277073910, Roche, Mannheim, Germany) and the MAXIscript in vitro Transcription Kit (#AM1312 ...
-
bioRxiv - Developmental Biology 2021Quote: Digoxigenin-labelled sense and antisense RNA probes were prepared by in vitro transcriptions using recombinant plasmids of target genes made as mentioned above (Roche Life Science) and used for in situ hybridization ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were transfected into HeLa cells growing on 100 mm dishes using X-treme GENE HP DNA transfection reagent (Roche, Laval, QC) according to manufacturer’s protocols and processed for TEM at 18 hours post transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... we performed a mutagenesis PCR using the primers [Phos]ATCGATTACAAGGATGACGATGACAAGGGTGGTGGTGGTAGTATGAAGCTACTGTCT TCTATCGAA and [Phos]GTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTCCATTTTGAAGTGGCCTGAA GTAAAGGA and the validation plasmid as template (25 μl KAPA HiFi HotStart ReadyMix (KAPA Biosystems KK2602), 1 μl 100 μM forward primer ...
-
bioRxiv - Microbiology 2022Quote: ... then guide sequences were amplified from gDNA and the plasmid pool by nested PCR using KAPA HIFI Hotstart PCR kit (Kapa Biosystems, KK2501), as previously described in (Young et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-cells were transfected with 1 µg Trop-2-pEYFP-N1 or Trop-2-Q118E-pEYFP-N1 plasmids using X-tremeGENE 9 DNA transfection reagent (Roche, Basel, Switzerland) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... the plasmid DNA was linearized by SalI digestion and transcribed by T7 RNA polymerase using Digoxigenin (Dig) RNA Labeling Mix (Roche Diagnostics, Germany) for 2 h at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cDNA inserts of the plasmids were isolated and amplified by low-cycle (12x) PCR using a Kapa2G Robust Hotstart PCR kit (Roche, Ref #07961073001) according to specifications ...
-
bioRxiv - Immunology 2024Quote: 293T cells were co-transfected with plasmids encoding cognate heavy and light chains using the Xtreme Gene 9 DNA transfection reagent (Roche, Basel, Switzerland), then grown in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum (FBS ...