Labshake search
Citations for Roche :
6301 - 6350 of 6468 citations for Alpaca ZAP Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems, Woburn, MA) prior to cluster generation.
-
bioRxiv - Microbiology 2021Quote: ... The pellet was suspended in 100 μL of staining solution containing FITC-conjugated Annex-in-V and propidium iodide (Annexin-V-Fluos Staining Kit, Roche Molecular Biochemicals, Germany) and incubated for 15 min at 20 °C ...
-
bioRxiv - Paleontology 2022Quote: DNA library construction for whole-genome sequencing was performed using the KAPA Hyper Prep Kits for Illumina® NGS platforms (KAPA Biosystems, KK8504). Adapters and 8bp index oligos purchased from IDT® (Integrated DNA Technologies ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reactions were performed using 50 ng of metagenomic DNA per sample using the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, USA). The individual PCR reactions were performed in 20 µL final volume and containing 4 µL of 5X Kapa HiFi Buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... The cDNA was diluted 20-fold and used for qRT-PCR employing a LightCycler® 480 SYBR Green 1 Master PCR labelling kit (Roche Applied Sciences) and RotorGene 3000 Real time PCR machine (Corbett Research ...
-
bioRxiv - Immunology 2020Quote: ... using the Ovation RNA-Seq System (NuGEN Technologies Inc., San Carlos, CA) followed by KAPA Hyper library preparation kits (KAPA Biosystems, Wilmington, MA) on an Illumina NextSeq 500 sequencing platform with 76-bp ...
-
bioRxiv - Cancer Biology 2019Quote: Four RNA-seq libraries (from CER217, CER218, CER220, and CER221 strains) were prepared with the KAPA Stranded mRNA-Seq Illumina® Platforms Kit (Roche-Kapa Biosystems) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2019Quote: ... Reverse transcription of 1 µg RNA into cDNA was done using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Cancer Biology 2019Quote: ... Immunostaining was carried out using the BenchMark XT (Ventana Medical Systems, Illkirch Graffenstaden, France) with the OmniMap kit (a “biotin-free” system using multimer technology, Roche, Boulogne Billancourt, France) and a Tris borate EDTA pH8 buffer for antigen retrieval ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 8μm thick tissues were subjected to TUNEL staining according to the manufacturer’s instructions for an In-Situ Cell Death Detection Kit (Cat. 11684817910, Roche Diagnostics, Indianapolis, IN, USA). Sections were then visualized with a fluorescence microscope (Nikon ...
-
bioRxiv - Molecular Biology 2020Quote: ... Resulting cDNAs were qPCR amplified using the Roche LightCycler 480 SYBR Green I Master kit and the LightCycler® 480 instrument (Roche Applied Science). Cycling conditions were set at 95°C for 30 s ...
-
bioRxiv - Microbiology 2021Quote: ... The dsRNA-seq library was prepared according to KAPA KK8540 RNA HyperPrep kit with 201-300 bp insert size (KAPA Biosystems, Wilmington, MA) using 25-50 ng of total dsRNA as input ...
-
bioRxiv - Zoology 2019Quote: ... PCR products were visualized on a 1.5% agarose gel and cleaned using the HiPure PCR product Cleanup kit (Roche Life Sciences, Indianapolis, IN) and sent for sequencing at Macrogen USA (Rockville ...
-
bioRxiv - Molecular Biology 2019Quote: ... and an equimolecular pool of libraries was prepared and titrated by qRT-PCR using the “Kapa-SYBR FAST qPCR kit forLightCycler480” (Kapa BioSystems, Fritz Hoffmann-La Roche, Basilea, Switzerland) and a reference standard for quantification (Genomics Unit ...
-
bioRxiv - Genomics 2021Quote: ... Paired-end multiplex libraries were prepared according to the instructions of the manufacturer with the KAPA PE Library Preparation kit (Kapa Biosystems, Wilmington, MA). Libraries were loaded to Illumina flow-cells for cluster generation prior to producing 100 bp paired-end reads on a HiSeq2000 instrument following the Illumina protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 500 μg total RNA was used to prepare polyA-enriched RNA-seq libraries using the KAPA mRNA Hyper Prep Kit (Roche, ref. KK8581/KK8581). Those libraries were prepared separately for each sample with 11 amplification cycles ...
-
bioRxiv - Microbiology 2021Quote: ... The purified DNA was used for Illumina sequencing library construction using a KAPA Hyper Prep Kit (for Illumina) (KAPA Biosystems, Wilmington, MA, USA). Sequencing was performed on an Illumina HiSeq 2500 platform (San Diego ...
-
bioRxiv - Developmental Biology 2021Quote: ... according to the manufacturer’s instruction and 1 microG of total RNA was reverse transcribed into cDNAs using the first-strand synthesis kit (Roche, Tucson, AZ, USA). Real-time quantitative PCR analyses were performed according to a previously published procedure 39 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The libraries were quality controlled on an Agilent 2100 Bioanalyzer with the DNA 7500 assay for size and the concentration was estimated using quantitative PCR with the KAPA Library Quantification Kit Illumina® Platforms (Roche Kapa Biosystems). To obtain sufficient amount of libraries for sequencing it was necessary for the low input libraries (0,1 - 0,2 ug ...
-
bioRxiv - Immunology 2020Quote: ... One hundred ng of total RNA from each sample was used to prepare total RNA libraries using the KAPA Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems, Massachusetts, USA). Fragmentation prior to first strand cDNA synthesis was carried out using incubation conditions recommended by the manufacturer for intact RNA samples (94 °C for 6 minutes (min)) ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA of all VSV-spike pseudovirus particles were extracted from 200ul supernatant using the High Pure Viral RNA Kit (Roche, Cat. No. 11858882001) following the supplier’s manual ...
-
bioRxiv - Microbiology 2022Quote: ... #439259) or HeV (Advanced Cell Diagnostics Inc #410719) and detected using the Discovery mRNA purple HRP detection kit (Roche Tissue Diagnostics #760-255) on the Ventana Discovery ULTRA staining platform (Roche Tissue Diagnostics) ...
-
bioRxiv - Developmental Biology 2022Quote: Testes from adult mice were cut into ~20 mg pieces and transferred into ~200 μl pre-cooled denaturing buffer from the Minute Total Protein Extraction Kit (SD-001, Invent Biotech, Plymouth, MN, USA) containing protease inhibitors (CO-RO, Roche, Indianapolis, IN, USA) and phosphatase inhibitors (PHOSS-RO ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We prepared dual- indexed libraries (Glenn et al. 2019) for targeted enrichment using the KAPA Hyper Prep Library Kit (KAPA Biosystems, Wilmington, MA) following manufacturer’s protocols ...
-
bioRxiv - Genetics 2022Quote: ... Sense and antisense digoxigenin (DIG)-labeled probes were synthesized from the purified PCR product using DIG RNA Labeling Kit (Roche, cat. no.11175025910). All primer sequences were listed in Supplementary Information (Supplementary Table 3).
-
bioRxiv - Genetics 2022Quote: Southern blot analysis was performed to ensure that the foreign gene Bar was present in randomly excised segments of the T2 transformed soybean genome by following the protocol from the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche, Indianapolis, IN, USA). DNA was extracted from the plants with positive PCR results ...
-
bioRxiv - Developmental Biology 2022Quote: ... QPCR was performed using the LightCycler® FastStart DNA Master PLUS SYBR Green I kit and a light cycler 2.0 (Roche Life Science, France) as previously reported 7
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were prepared by the Van Andel Genomics Core from 500 ng of total RNA using the KAPA RNA HyperPrep Kit with RiboseErase (v1.16) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Developmental Biology 2022Quote: ... Digoxygenin-labeled sense and antisense probes were synthesized from the linearized plasmids using the DIG RNA Labeling Kit (SP6/T7) (Roche/MilliporeSigma, Burlington, MA). Whole-mount ISH was performed as previously described (Yan et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time RT-PCR was then performed using the KAPA SYBR FAST qPCR Master Mix (2x) Kit (Kapa Biosystems, Cape Town, South Africa) in LightCycler 480® (Roche ...
-
bioRxiv - Pathology 2024Quote: ... The resulting PCR products were then used as a template for generation of sense and antisense DIG-labelled probes using a DIG-nucleotide labelling kit (Roche, Indianapolis, IN, USA). Hybridised probes within the nematode tissues were detected using an anti-DIG antibody conjugated to alkaline phosphatase and its substrate ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... The resulting PCR products were then used as a template for generation of sense and antisense DIG-labelled probes using a DIG-nucleotide labelling kit (Roche, Indianapolis, IN, USA). Hybridised probes within the nematode tissues were detected using an anti-DIG antibody conjugated to alkaline phosphatase and its substrate ...
-
bioRxiv - Microbiology 2023Quote: First-strand cDNA synthesis and quantitative real-time PCR was performed using the KAPA SYBR® FAST kit (CliniSciences) on the LightCycler® 480 (Roche Diagnostics) using the primers indicated in Supplementary Table S6 ...
-
bioRxiv - Plant Biology 2024Quote: ... was performed in 2-day-old cells according to the manufacturer’s protocol (TMR red in situ cell death detection kit, Roche Diagnostics GmbH, Heidelberg, Germany) with modifications as described earlier (Smetana et al. ...
-
Tryptophan Metabolites And Their Predicted Microbial Sources In Fecal Samples Of Healthy IndividualsbioRxiv - Microbiology 2024Quote: ... Libraries were amplified for 13 PCR cycles in 50 μl reactions containing 150 pmol of P1.1 (5’-AATGATACGGCGACCACCGAGA) and P3 (5’-CAAGCAGAAGACGGCATACGAGA) primer and Kapa HiFi HotStart Library Amplification kit (Cat# kk2612, Roche Sequencing and Life Science). Library quantification and size estimation were performed using a Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... brain sections were processed for DNA strand breaks using Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) from Fluorescence In Situ Cell Death Detection kit (Roche Diagnostic, Indianapolis, IN) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Illumina adapters (AGA TCG GAA GAG CGT CGT GTA GGG AAA GAG TGT AGA TCT CGG TGG TCG CCG TAT CAT T and AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GACGCT CTT CCG ATC TNN***) were ligated and DNA-cDNA chimeras were then amplified with the KAPA HiFi kit (Roche, Cat. No. 07958838001). PCR products were enriched for fragments >200 bp and sequenced on a NextSeq2000 instrument (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... The levels of βGAL and CAT were measured according to the protocol of the β-Gal Reporter Gene Assay kit (Roche, cat. # 11758241001) and the CAT ELISA kit (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... We used the Agilent Bioanalyzer to assess the quality of the library and a qPCR approach with the KAPA Library Quantification Kit (Roche; P/N: KK4873) on the QuantStudio 12K device to quantify the library ...
-
bioRxiv - Genetics 2024Quote: ... Strand-specific and dual-barcode indexed RNA-seq libraries were generated from 450 ng total RNA each using the Kapa RNA-seq Hyper kit (Kapa Biosystems-Roche, Basel, Switzerland) and both the QIAseq FastSelect–5S/16S/23S ribodepletion and FastSelect rRNA Plant reagents (Qiagen ...
-
bioRxiv - Genetics 2024Quote: ... they were quantified on a CFX 384 Touch Real-Time PCR Detection System using the KAPA Library Quantification Kit (KAPA Biosystems, cat. KK4824). Finally ...
-
bioRxiv - Genomics 2023Quote: ... DNA-Seq libraries were prepared from 1 mg of DNA extracted from young leaves using the Kapa LTP library prep kit (Kapa Biosystems, MA, USA). After quantity and quality evaluation with the High Sensitivity chip of a Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... was depleted from the total RNA samples using the RiboErase module of the KAPA RNA Hyper+RiboErase HMR Kit (Roche Cat. No. 08098140702). The rRNA-depleted RNA was then applied for library preparation ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µl RNA eluate was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche ...
-
bioRxiv - Pathology 2023Quote: ... was performed with RNAscope® 2.5 VS Reagent Kit (323250, Advanced Cell Diagnostics, Newark, CA) on a Ventana Discovery Ultra platform (Roche Diagnostics, Penzberg, Germany). Sections were exposed to 24 hours antigen retrieval and 16 min protease treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified based on the manufacturer’s instructions before sample barcoding with xGen Stubby Adapter and Unique Dual Index Primers (IDT) and library preparation using KAPA HyperPrep Kit (Kapa Biosystems-Roche, Wilmington, MA). The library was then sequenced by Illumina MiSeq nano PE150 at the Georgia Genomics and Bioinformatics Core ...
-
bioRxiv - Neuroscience 2022Quote: ... brain sections as previously described (46) (Iba-1 staining was conducted on a Ventana Benchmark using OptiView and UltraView detection kits provided by Roche (Roche Molecular Systems, Inc). Sections were deparaffinized in xylene and rehydrated through an ethanol series ending in distilled water ...
-
bioRxiv - Pathology 2023Quote: ... The RT-qPCR reactions were performed as recommended by the kit protocol and run on a Roche Light Cycler (Roche, Indianapolis, IN, USA). The limit for cycle of quantification was defined at less than 29 ...
-
bioRxiv - Immunology 2022Quote: Tumor tissue sections were subjected to the terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick-end labeling (TUNEL) assay using the In Situ Cell Death Detection Kit (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s protocol ...