Labshake search
Citations for Roche :
6101 - 6150 of 6468 citations for Alpaca ZAP Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: Sequencing libraries were prepared following (Meyer and Kircher, 2010) and using the SeqCap EZ library preparation kit (Roche Nimblegen, Madison, WI, USA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... The concentration of the pooled samples was determined using the Kapa Biosystems library quantification kit for Illumina platforms (Kapa Biosystems, MA, USA). Agilent Bioanalyzer high- sensitivity DNA analysis kit (Agilent CA ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA of 1 μg from each sample was reverse transcribed with random hexamers using Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... of these dilutions were used to prepare the reaction mixes for the real-time qRT-PCR using the KAPA SYBR FAST One-Step Universal kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... washing and detection were performed according to instructions of the DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannheim, Germany).
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25 μl containing inner primer pairs (50 nM each ...
-
bioRxiv - Plant Biology 2020Quote: ... antisense RNA probes were generated using a DIG-labeling kit and the resulting probes hydrolyzed as previously described (Roche Diagnostics, IN, USA) (36) ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were then processed for immunohistochemistry using the Discovery Ultra automated processor (Ventana Medical Systems) with a ChromoMap DAB kit (Roche Tissue Diagnostics).
-
bioRxiv - Plant Biology 2021Quote: ... and quantified by RT-qPCR in a Bio-Rad CFX384 Touch detection system using the KAPPA KK4824 kit (Kapa Biosystems, Wilmington, USA). Two 150-bp single-end sequencing libraries were prepared using the NextSeq 500/550 High Output Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were quantified using KAPA Library Quantification kits for Illumina Sequencing platforms according to the qPCR Quantification Protocol Guide (KAPA BIOSYSTEMS, #KK4854). Finally ...
-
bioRxiv - Neuroscience 2020Quote: Total genomic DNA was extracted from myoblasts from all participating patients using a High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland).
-
bioRxiv - Microbiology 2021Quote: ... The concentration of the pooled samples was determined using the Kapa Biosystems library quantification kit for Illumina platforms (Kapa Biosystems, MA, USA). Agilent Bioanalyzer high sensitivity DNA analysis kit (Agilent CA ...
-
bioRxiv - Neuroscience 2020Quote: ... One microgram of the total RNA was reverse-transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Florham Park, NJ). qPCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2019Quote: ... and was used to prepare libraries for RNA sequencing using the KAPA mRNA HyperPrep Kit according to the manufacturer’s instructions (KAPA Biosystems, Wilmington, MA). Libraries were quality control checked via Qubit (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... Southern blot was performed using the DIG High Prime DNA Labeling and Detection Starter kit I according to the manufacturer’s instructions (Roche Diagnostics, Mannheim, Germany). The specific sequence was amplified from Hph gene using primer pairs (Supplemental Table S2) ...
-
bioRxiv - Immunology 2020Quote: ... generation of TCR libraries and generation of amplicons for deep sequencing were performed using the KAPA HiFi PCR kit with GC buffer (Roche Diagnostics, #07958846001) and custom designed primers (Supplementary Table 6) ...
-
bioRxiv - Plant Biology 2021Quote: ... Target DNA capture was performed as previously described (24) with slight modifications using a SeqCap EZ Hybridisation Wash Kit (Nimblegen/Roche, Madison, USA) and Dynabeads M-270 Streptavidin (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... The sheared DNA fragments were end-repaired and deoxyadenosine-tailed in a 60 µL volume with 3 µL End Repair & A-Tailing Enzyme Mix and 7 µL End Repair & A-Tailing Buffer using a KAPA Hyper Prep Kit (KAPA Biosystems, USA) according to the manufacturer instructions (20°C 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification of the 16S rRNA gene was performed using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, MA, USA) with an inner primer pair (50 nM for each ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was carried out on an QuantStudio™ 6 Flex Real-Time PCR System using a SYBR green-based real-time kit (Kapa Biosystems). The RNA polymerase II subunit ama-1 was used as the house-keeping control ...
-
bioRxiv - Molecular Biology 2022Quote: ... negative and positive samples contained an equivalent volume of HBsAg-specific diluent ([HBSAGQ2 Dil HepB] from the Elecsys HBsAg II quant II immunoassay kit (Roche Diagnostics International) and were used to exclude unknown contamination within the experimental setup and laboratory environment ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... According to the manufacturer’s protocol for Southern blot hybridization and detection digoxigenin-labeled hybridization probes (DIG DNA Labeling and Detection Kit, Roche Applied Science, 11175033910) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... The cell viability following 4-AP treatment was assayed by MTT assay according to manufacturer’s protocols (Roche, cell proliferation kit I (MTT), # 11465007001) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were scraped and lysed in lysis buffer of Pierce Crosslink IP Kit (Thermo/Pierce) with complete protease inhibitor cocktail tablet (Roche Applied Sciences). Cell lysates were incubated overnight at 4°C with anti-Myc-sepharose made with anti-Myc antibody (Cell signaling ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... Each region was amplified from 5 μl of the RNA preparation by RT-PCR using Transcriptor One Step RT-PCR kit (Roche Applied Science). To perform the RT-PCR ...
-
bioRxiv - Pathology 2022Quote: ... was isolated from either the IFP or replacement tissue that remained in formalin-fixed paraffin-embedded blocks following acquisition of adequate sections for histopathology and immunohistochemistry (IHC) using a commercially available kit specifically designed for such (Roche, Basel, Switzerland). A custom set of guinea pig-specific probes were designed and manufactured by NanoString Technologies (Seattle ...
-
bioRxiv - Pathology 2022Quote: We detected DNA fragmentation resulting from apoptotic signaling cascades with the In Situ Cell Death Detection Kit Fluorescein (Roche, 11684795910, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... by the capillary method and hybridised with digoxigenin-labelled blaOXA- 58 and blaNDM-1-specific probes with an NBT/BCIP colour detection kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Final libraries were checked for quality and quantity using the Agilent TapeStation system and qPCR using a KAPA Library Quantification Kit for Illumina sequencing platforms (Kapa Biosystems, Roche). Sequencing was conducted in the Illumina NovaSeq platform (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: Gene expression analysis via RT-qPCR was performed using a LightCycler480 instrument and LightCycler480 SYBR Green Master Kit reagents (Roche, Indiana, IN). Relative gene expression levels were determined using a standard curve method ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed as described in Han et al., 2018 (Han et al., 2018) using KAPA SYBR® FAST qPCR Kit Master Mix on LightCycler® 96 instrument (Roche). Relative expression was calculated by dividing ACTIN2 gene expression over the specific-gene expression and the fold change was calculated by dividing estradiol expression over DMSO (mock ...
-
bioRxiv - Biochemistry 2021Quote: Cell-free histone levels were assessed in plasma from healthy controls and COVID-19 patients using a photometric enzyme immunoassay (Cell Death Detection ELISAPLUS kit, Roche Applied Science) that measures histone-associated DNA fragments according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... Nucleic acids from these 200μL mosquito pools and from 100μL venous and finger prick whole blood samples in RNAprotect Cell Reagent were isolated using the bead-based MagNAPure LC automatic extractor (Total Nucleic Acid Isolation Kit—High Performance, Roche Applied Science) and eluted in 50μL of water ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg of RNA was converted to cDNA using an oligo dT primer and the Transcriptor First Strand cDNA Synthesis kit (Roche Molecular Systems). qPCR was performed using PowerUp SYBR Green (Applied Biosystems Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... the LDH release in cell culture supernatant from infected cells was measured at 24 h and 96 hpi by using the colorimetric kit (Roche, Mannheim, Germany) and following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... was selected based on the levels of CAT expression which were determined in brain tissue homogenates of two-month old CAG-CAT-Prnp mice using the CAT ELISA kit (Roche, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was then provided to the Functional Genomics Laboratory at UC Berkeley where RNA-seq libraries were prepared by Oligo dT enrichment followed by a stranded Illumina library prep protocol with the KAPA mRNA HyperPrep kit (Kapa Biosystems, KK8580). Libraries were checked for quality on an AATI Fragment analyzer (Agilent ...
-
bioRxiv - Neuroscience 2020Quote: The extent of cell death following MPP+ treatment with and without LMX1B overexpression was assessed by using the terminal deoxynucleotidyl transferase mediated dUTP-biotin nick end-labeling (TUNEL) method (In situ cell death detection kit, TMR red, Roche, Cat# 12156792910), according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2022Quote: ... Extraction of total nucleic acid was performed using the MagNA Pure 96 DNA and Viral NA Small Volume Kit in the MagNA Pure 96 system (Roche, Penzberg, Germany), and eluted in a volume of 50μl Roche Tris-HCl elution buffer ...
-
bioRxiv - Genetics 2019Quote: ... Partial f5 cDNA fragments were amplified to synthesize sense and antisense digoxin-labeled RNA riboprobes (DIG RNA labeling kit, Roche, Basel, Switzerland) (Table 1) ...
-
bioRxiv - Neuroscience 2019Quote: ... Accurate quantification of the final libraries for sequencing applications was determined using the qPCR-based KAPA Biosystems Library Quantification kit (Kapa Biosystems, Inc.). Each library was diluted to a final concentration of 12.5 nM and pooled equimolar prior to clustering ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Ki-67 was performed automatically on a Ventana Benchmark XT autostainer system with the XT ultra-View DAB Kit (Ventana Medical Systems, Roche, Basel, Switzerland). Primary antibodies were the monoclonal anti-PD-L1 antibody raised in rabbit (1:100 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The samples were boiled at 95°C for 5 minutes and diluted 1:1000 in dilution buffer provided in ATP luminescence kit HSII (Roche, Cat# 11699709001). The further assay was performed as instructed by the kit’s manual in Luminometer (Promega GloMax96 Microplate Luminometer) ...
-
bioRxiv - Zoology 2019Quote: ... In vitro transcription of DNA template was carried out using thermocycler followed by RNA probe synthesis using DIG RNA labelling kit using manufactures protocol (Roche Diagnostics, Germany). DIG labelled mRNA was synthesized and analysed using agarose gel electrophoresis and sequencing.
-
bioRxiv - Bioengineering 2019Quote: ... Hybridization and washing were performed according to the procedures of DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannhein, Germany). The membranes were imaged using UVP software.
-
bioRxiv - Microbiology 2019Quote: ... The V3-V4 region of the 16S rRNA gene was PCR amplified using the KAPA HotStart PCR Kit (Kapa Biosystems, Wilmington, MA) with 10 µL Kappa HotStart Mastermix ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was diluted to a final concentration of 5 ng/μl and RT–qPCR was performed with KAPA SYBR® FAST qPCR kits (KAPA Biosystems) on a C1000 thermal cycler ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the operating procedures according to the protocol supplied by the manufacturer of DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannheim, Germany). The prober primes are shown in supplementary (Table S3).