Labshake search
Citations for Roche :
551 - 600 of 10000+ citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared from 2.5 ng of each sample using either the KAPA HyperPlus Kit (replicate 1: Roche/KAPA Biosystems, KK8512) or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... samples were covered with the staining mixture at 37 °C for 1 h following instructions of the In Situ Cell Death Detection Kit (Roche, 11684795910). After the TUNEL reaction ...
-
bioRxiv - Cell Biology 2019Quote: ... protein was isolated from hMPCs with RIPA buffer containing phosphatase (PhosSTOP, Roche) and protease (cOmplete ...
-
bioRxiv - Cell Biology 2020Quote: ... and protein was eluted by cleaving with 20 U/ml thrombin (Roche) in TCB (50 mM Tris ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... resuspended in protein resuspension buffer (2% SDS, 10 mM NaF, 1x Roche cOmplete Mini proteinase inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2020Quote: ... Soluble protein was purified using batch/gravity-flow affinity chromatography (cOmplete, Roche). MED1 (50-660 ...
-
bioRxiv - Developmental Biology 2020Quote: ... GFP and FLAG tagged proteins were visualized by mouse anti-GFP (Roche) and anti-FLAG M2 antibodies (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... Protein was detected by incubation with a solution of NBT/BCIP (Roche) as per the manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies used for immunoprecipitation were Protein G Agarose beads (Roche, 1124323301) and anti-FLAG (M2 ...
-
bioRxiv - Genomics 2021Quote: ... proteins were visualized using the lumi-light plus western blotting substrate (Roche).
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were immunologically detected by using anti-HA (3F10)-HRP (Roche, Switzerland) or anti-Myc-tag (HRP-DirecT ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected with Anti-c-myc-Peroxidase (Roche #11814150001) at dilution of 1:5,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... the proteins were transferred onto a PVDF membrane (Roche Diagnostics, Mannheim, Germany). Cofilin1 and phospho-Cofilin1 (Ser3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were lysed and sonicated in RIPA buffer with protein inhibitors (Roche). Protein concentrations were estimated by BCA assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... and subsequently proteins were digested by addition of proteinase K (Roche #03115852001) at 37°C ...
-
bioRxiv - Plant Biology 2022Quote: ... and proteins were eluted by using 0.25 mg/ml HA peptide (Roche). HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... Immune complexes were captured using 20 µl Protein A agarose beads (Roche, previously saturated with 1 mg/ml BSA and 1mg/ml yeast tRNA ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected using anti-myc antibody (mouse monoclonal; Roche) di-luted 1:5000 (v/v) ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were extracted using EB2 supplemented with 1X PhosSTOP (Roche, Indianapolis, IN) and FLAG immunoprecipitation was performed using anti-FLAG M2 agarose (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA-protein complexes were immunoprecipitated using a monoclonal anti-GFP antibody (Roche). Analysis of enrichment of target genes was performed by qPCR using the oligos listed in the Table S2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and proteins were digested with 0.04 mg/mL proteinase K (Roche #03115852001). DNA was recovered using a DNA purification kit (Bioline #52060) ...
-
bioRxiv - Neuroscience 2022Quote: ... protein G-Sepharose Fast Flow and immobilized streptavidin Mutein Matrix from Roche; protein molecular weight standards from Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... After last wash proteins were cleaved by adding sequencing grade trypsin (Roche) in a 1:100 trypsin:protein ratio ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... Fusion proteins were detected with α-Myc monoclonal antibodies (Roche, Stockholm, Sweden). The following constructs were used ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μL of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... and subsequently incubated with 20 μL of protein G-agarose beads (Roche) or protein A-agarose beads (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were then degraded by addition of 50 µg Proteinase K (Roche) and incubation at 56°C for 90 minutes ...
-
bioRxiv - Cell Biology 2023Quote: The TetR-eYFP tagged proteins were transfected using the XtremeGene-9 (Roche) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein pellets were suspended in in cOmplete Protease Inhibitor Cocktail (Roche) containing radio-immunoprecipitation assay (RIPA ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA of 1 μg from each sample was reverse transcribed with random hexamers using Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... by the capillary method and hybridised with digoxigenin-labelled blaOXA- 58 and blaNDM-1-specific probes with an NBT/BCIP colour detection kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... The samples were boiled at 95°C for 5 minutes and diluted 1:1000 in dilution buffer provided in ATP luminescence kit HSII (Roche, Cat# 11699709001). The further assay was performed as instructed by the kit’s manual in Luminometer (Promega GloMax96 Microplate Luminometer) ...
-
bioRxiv - Plant Biology 2020Quote: ... In situ nick-end labeling of nuclear DNA fragmentation was performed for 1 h in the dark at 37°C using the In-Situ cell death detection kit (Roche Applied Science) according to the manufacturer’s manual ...
-
bioRxiv - Cell Biology 2020Quote: ... Mip1α and housekeeping gene β-actin was evaluated by quantitative RT-PCR using the LightCycler 480 SYBR Green 1 Master kit and LightCycler 480 II (Roche, Indianapolis, IN) and oligos ...
-
bioRxiv - Plant Biology 2019Quote: ... and 1 µg RNA was used for cDNA synthesis with oligo(dT)12-18 using Transcriptor first-strand synthesis kit (Roche, Basel, Switzerland). Transcript levels were measured by qRT-PCR using LightCycler 480 SYBR Green I Master (Roche ...
-
bioRxiv - Pathology 2022Quote: RNA was reverse-transcribed and amplified using the TaqMan Fast Virus 1-Step Master Mix RT-qPCR kit (LifeTechnologies, Carlsbad, CA) on the LightCycler 480 or LC96 instrument (Roche, Indianapolis, IN), and quantified by interpolation onto a standard curve made up of serial tenfold dilutions of in vitro transcribed RNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... a maximum of 1 μg of sheared DNA was used for library preparation using the KAPA HTP Prep Kit (KAPA Biosystems, KK8234) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5 min or TRAP staining with a TRAP/ALP Stain Kit (FUJIFILM Wako Pure Chemical Corporation) for 30 min or ALP staining with NBT/BICP solution (Roche; 1:100) for 15 min followed by AR staining prepared from 1% AR Solution at pH 6.3-6.4 (MUTO PURE CHEMICALS CO. ...
-
bioRxiv - Evolutionary Biology 2024Quote: Paired-end sequencing libraries for QTL-Seq analysis were prepared using >1 μg of pooled DNA with a KAPA HyperPrep PCR-free kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Exome libraries were prepared from 1 μg of genomic DNA from each analyzed section using the Nimblegen EZ Exome kit V3 (Roche, Nutley, NJ). Paired-end 100 bp sequencing was performed on a HiSeq2500 sequencer (Illumina Inc. ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...