Labshake search
Citations for Roche :
551 - 600 of 8180 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... cell line using X-tremeGENE 9 DNA transfection reagent (Roche). 48 h after transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... using X-tremeGENE 9 DNA transfection reagent (Roche, cat# 6365779001) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and transfected 24 h later using Xtreme-GENE 9 (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were seeded and transfected using XtrememGene 9 (Roche, USA) according to manufacturer’s manual 48 h prior to infection ...
-
bioRxiv - Cell Biology 2021Quote: ... pX330-based plasmids were transfected using X-tremeGENE-9 (Roche) together with a mCherry-expressing plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... containing AAVS1-targeting recombination arms [62] using XtremeGene 9 (Roche). Transfected cells were allowed to recover for 48 hrs before treatment with 1 μg/ml puromycin (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 24 h) using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... media containing 24 μL of X-tremeGENE 9 DNA (Roche) and added to HEK cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.4 µg vsFULL envelope plasmid using Xtremegene-9 (Roche). After 16 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... inguinal adipose tissue was digested in a PBS buffer containing 10 mg/mL collagenase D (Roche), 2.4 U/mL dispase II ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µg of a WEAU gp160 plasmid (pcDNA3.1-WEAU gp160) into exponentially dividing 293T/17 cells using FuGENE 6 (Roche Applied Science, Indianapolis, IN) or into 293F cells using 293fectin (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Dynamic monitoring of cell growth was determined every 12 hours during 6 days using the impedance-based xCELLigence system (Roche Applied Science, Germany). The cell index was derived from measured cell-electrode impedance that correlates with the number of viable cells.
-
bioRxiv - Developmental Biology 2022Quote: ... 10% glycerol + 1:10 cOmplete mini protease inhibitor cocktail (Roche)) by incubation on ice followed by sonication (Bioruptor ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Cell Biology 2019Quote: ... allowed to adhere overnight and transfected with the indicated splicing reporter constructs (1 µg/well) using X-tremeGENE 9 (Roche). As shown in the Key Resources Table ...
-
bioRxiv - Molecular Biology 2022Quote: Mouse pancreata from adult mice (9-14 week old) were perfused with a solution containing 1 mg/mL collagenase-P (Roche) in Hank’s buffered salt solution (HBSS ...
-
bioRxiv - Immunology 2019Quote: ... 2.93mg/ml collagenase B (Roche, 11088815001) and 1.9mg/ml DNase (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... and B (1.8 mg/mL, Roche) supplemented with 1% Penicillin/Streptomycin for 12 hours at 37 °C using end-over-end shaker ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1mg/mL Collagenase B (Roche 11088815001), 4U/mL Hyaluronidase (Sigma H3506) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... hygromycin B was purchased from Roche Applied Science ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-SPD-5 (1:1000, a generous gift from B. Bowerman, Hamill et al., 2002) and anti-GFP (1:500, Roche) overnight at 4°C and with secondary antibodies Alexa488 (1:500 ...
-
bioRxiv - Cancer Biology 2021Quote: Tissue sections were dissected using the reference mask image from serial section 6 to collect regions of interest using medium or large AVENIO Millisect milling tips (Roche Sequencing Solutions, Pleasanton, CA), collected with Molecular Grade Mineral Oil (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Plant Biology 2024Quote: ... The transformation mixture was plated on TAP medium containing 18 μg/ml Hygromycin B (Roche 10 843 555 001; Mannheim, Germany) using 0.9% agar to screen for colony morphology ...
-
bioRxiv - Microbiology 2020Quote: ... Protein translation was induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG, 11411446001, Roche Diagnostics) and cultures were incubated overnight at 18 °C ...
-
bioRxiv - Immunology 2019Quote: Spleens and dLN were treated with collagenase D (1 mg/ml, Roche) and DNAse I (100 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 1 mg/mL collagenase D (Roche, Welwyn Garden City, UK) and 25 µg/mL DNase 1 (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Enzymatical digestion was performed with 1 mg/mL collagenase D (Roche Diagnostics) and 50 µg/mL DNase I (Roche Diagnostics ...
-
bioRxiv - Immunology 2021Quote: ... Enzymatic digestion was first performed with collagenase D (1 mg/mL) (Roche) and DNase I (1 mg/mL ...
-
bioRxiv - Immunology 2022Quote: Tumors were minced and digested with Collagenase D (1 mg/mL, Roche) and DNAse I (50 μg/mL ...
-
bioRxiv - Bioengineering 2023Quote: ... LNs were digested with 1 mg/mL Ca2+ supplemented Collagenase D (Roche) for 30 min at 37°C and mashed into a single cell suspension.
-
bioRxiv - Cell Biology 2021Quote: ... On Day 0 (start of differentiation) hPSCs were treated with 1 mg/ml Collagenase B (Roche) for one hour ...
-
bioRxiv - Cell Biology 2022Quote: ... muscles were mechanically disaggregated and dissociated in DMEM 1% P/S media containing collagenase B (Roche) 0.2% and Calcium dichloride (CaCl2 ...
-
bioRxiv - Cell Biology 2022Quote: Cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche). To generate retroviral particles ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche), and 24 hours later 8000 GFP+ cells were sorted into a well of six-well plate ...
-
bioRxiv - Genomics 2019Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Biophysics 2021Quote: ... and cells were transfected using the Xtreme-Gene 9 reagent (Roche) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection reagent (Roche), with 1.2 µl X-tremeGENE reagent per 500 µg DNA reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... using X-treme GENE 9 DNA transfection reagent (Roche, XTG9-RO) to produce the lentiviral particles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... X-tremeGENE™ 9 DNA Transfection Reagent was bought from Roche Pharma (Reinach ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were lysed in 50 μl of Lysis Buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1x Roche Complete protease inhibitors cocktail) by pipetting up and down ...