Labshake search
Citations for Roche :
601 - 650 of 8606 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... cholesterol (Roche Cobas b 101 Lipid), triglycerides (Roche Cobas b 101 Lipid) ...
-
bioRxiv - Genetics 2024Quote: ... triglycerides (Roche Cobas b 101 Lipid), HbA1c (Roche Cobas b 101 HbA1c ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-SPD-5 (1:1000, a generous gift from B. Bowerman, Hamill et al., 2002) and anti-GFP (1:500, Roche) overnight at 4°C and with secondary antibodies Alexa488 (1:500 ...
-
bioRxiv - Cancer Biology 2021Quote: Tissue sections were dissected using the reference mask image from serial section 6 to collect regions of interest using medium or large AVENIO Millisect milling tips (Roche Sequencing Solutions, Pleasanton, CA), collected with Molecular Grade Mineral Oil (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Plant Biology 2024Quote: ... The transformation mixture was plated on TAP medium containing 18 μg/ml Hygromycin B (Roche 10 843 555 001; Mannheim, Germany) using 0.9% agar to screen for colony morphology ...
-
bioRxiv - Microbiology 2020Quote: ... Protein translation was induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG, 11411446001, Roche Diagnostics) and cultures were incubated overnight at 18 °C ...
-
bioRxiv - Immunology 2019Quote: Spleens and dLN were treated with collagenase D (1 mg/ml, Roche) and DNAse I (100 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 1 mg/mL collagenase D (Roche, Welwyn Garden City, UK) and 25 µg/mL DNase 1 (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Enzymatical digestion was performed with 1 mg/mL collagenase D (Roche Diagnostics) and 50 µg/mL DNase I (Roche Diagnostics ...
-
bioRxiv - Immunology 2021Quote: ... Enzymatic digestion was first performed with collagenase D (1 mg/mL) (Roche) and DNase I (1 mg/mL ...
-
bioRxiv - Immunology 2022Quote: Tumors were minced and digested with Collagenase D (1 mg/mL, Roche) and DNAse I (50 μg/mL ...
-
bioRxiv - Bioengineering 2023Quote: ... LNs were digested with 1 mg/mL Ca2+ supplemented Collagenase D (Roche) for 30 min at 37°C and mashed into a single cell suspension.
-
bioRxiv - Cell Biology 2021Quote: ... On Day 0 (start of differentiation) hPSCs were treated with 1 mg/ml Collagenase B (Roche) for one hour ...
-
bioRxiv - Cell Biology 2022Quote: ... muscles were mechanically disaggregated and dissociated in DMEM 1% P/S media containing collagenase B (Roche) 0.2% and Calcium dichloride (CaCl2 ...
-
bioRxiv - Cell Biology 2022Quote: Cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche). To generate retroviral particles ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche), and 24 hours later 8000 GFP+ cells were sorted into a well of six-well plate ...
-
bioRxiv - Genomics 2019Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Biophysics 2021Quote: ... and cells were transfected using the Xtreme-Gene 9 reagent (Roche) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection reagent (Roche), with 1.2 µl X-tremeGENE reagent per 500 µg DNA reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... using X-treme GENE 9 DNA transfection reagent (Roche, XTG9-RO) to produce the lentiviral particles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... X-tremeGENE™ 9 DNA Transfection Reagent was bought from Roche Pharma (Reinach ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were lysed in 50 μl of Lysis Buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1x Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 μg ml−1 pepstatin (Roche), 10 μg ml−1 chymostatin (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 μg ml−1 leupeptin (Roche), 10 μg ml−1 pepstatin (Roche) ...
-
Sapogenin based self-assembly structures activating a non-apoptotic cell death via multiple pathwaysbioRxiv - Pharmacology and Toxicology 2021Quote: ... the 10% WST-1 (Roche, Switzerland) in medium was replaced in each 96 well ...
-
bioRxiv - Cell Biology 2019Quote: ... 7 μg/ml transferrin (Cat.# 652202, Roche) and 150 units penicillin/streptomycin (Cat.#15140) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7 μl proteinase inhibitor 7X (Roche, 04693159001) and 5 μl phosphatase inhibitor 10X (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.025% pronase (Roche, 7 U/mg)] in complete DMEM/F-12 medium in a spinner flask ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TP53 (DO-7) (platform Ventana, Roche).
-
bioRxiv - Genomics 2022Quote: ... 0.1% Tween-20, 0,5% Triton X−100, 1 mM DTT, 1× protease inhibitors cocktail, complete EDTA-free, Roche and antifoam B, Sigma, 1:5000). The obtained extract was clarified by filtration through 1.6 μm GD/X Glass Microfiber syringe filters (25 mm ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 µg of 330-BFP-CYP3A4-enhancer-R-sgRNA were transfected with X-tremeGENE 9 DNA transfection reagent (Roche 6365809001). After 3-5 days ...
-
bioRxiv - Cancer Biology 2022Quote: ... in deionized phosphate-buffered saline (PBS)] supplemented with 1:7 proteases inhibitors cocktail (Roche Diagnostics GmBH, Germany) for 10 min ...
-
bioRxiv - Genomics 2022Quote: ... 1 μL of 1:10 diluted cDNA was used in a 10 μL SYBR Green (Roche, 04887352001) qPCR reaction on a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... Bacterial pellets were lysed in 10 ml B-PER Bacterial Protein Extraction Reagent (Pierce, Rockford, ILL) with Complete Protease Inhibitor Cocktail Tablets (Roche, Indianapolis, IN). Extracts were cleared by centrifugation ...
-
bioRxiv - Immunology 2020Quote: ... The remaining tissue was incubated in digestion buffer (RPMI 1640, 10% FCS, 1.25 mg/ml collagenase D (Roche), 0.85 mg/ml collagenase V (Sigma– Aldrich) ...
-
bioRxiv - Physiology 2024Quote: ... samples were diluted using buffer D (20mM HEPES, pH7.9, 10% Glycerol, 1mM EDTA, 1mM DTT, 0.5mM PMSF, 10mM NaF, Roche PhosSTOP ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were dissociated using collagenase B (Roche) and cultured in low cluster plates to allow EB formation in in RPMI 1640 base media (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... 4.6 mg Collagenase B (Roche, Basel, Switzerland) and 2 mg/ml Actinomycin D (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were dissociated using collagenase B (Roche) and cultured in low cluster plates to allow EB formation in serum-free differentiation SFD media supplemented with BMP4 (3 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... Collagenase B (CAT No: 11088815001) from Roche; CsCl (CAT No ...