Labshake search
Citations for Roche :
5701 - 5750 of 8095 citations for 7 Bromoacetyl 6 ethyl 1 2 3 4 tetrahydro 1 1 4 4 tetramethylnaphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... each sample was normalized to 3.5 ng in 5 µL water before generating libraries using a 1:10 Kapa HyperPlus (Roche) miniaturized protocol with barcoded indices as previously described82 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Dicer was detected using anti-HA 3F10 monoclonal primary antibody (High Affinity rat IgG1, Roche #11867431001; dilution 1:500), anti-HA rabbit primary antibody (Cell Signaling ...
-
bioRxiv - Microbiology 2024Quote: ... 500 μg cell lysate was diluted to 500 μL in lysis buffer supplemented with 1 mM DTT and 25 μg poly(dI:dC) (Roche) and precleared by incubating with 50 μL streptavidin beads for 1 hour at 4°C on rotating wheel ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein extraction buffer (150 mM NaCl, 1% Triton x-100, 50 mM TrisHCl pH 7.4 with protease inhibitor (11836170001 Roche)) ...
-
bioRxiv - Physiology 2024Quote: ... cells were lysed in IP buffer (10 mM Tris pH 8, 0.4% NP40, 300 mM NaCl, 10% glycerol, 1 mM DTT, antiprotease (Roche), anti-phosphatase (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 15 mM EDTA and 1% Nonidet P-40) supplemented with cOmpleteTM protease inhibitor and PhosSTOPTM phosphatase inhibitor cocktails (Roche). Lysates were subsequently subjected to GFP trapping ...
-
bioRxiv - Molecular Biology 2024Quote: ... was transferred to a new tube and the pellet was resuspended with 300 µl membrane lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% NP-40) supplemented with protease inhibitors (Roche). After 20 min of incubation the samples were centrifuged again at 100’000 for 30 min at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and ∼3 mg DNase I (Roche). MhOR5 was extracted using 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% NP40 (Roche 11332473001), 3 µL 10% Tween-20 (Roche 11332465001) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 mM imidazole and 10 % glycerol supplemented with EDTA-free protease inhibitor tablets (Roche; 1 tablet per 100 ml buffer) and lysozyme (1 mg/ml) ...
-
bioRxiv - Microbiology 2020Quote: ... 50 mM Tris/HCl pH8) to which protease inhibitors were freshly added (1 tablet of Complete protease inhibitor per 25 ml, Roche, Mannheim ...
-
bioRxiv - Cancer Biology 2021Quote: ... 150 mM NaCl, 1 mM PMSF, 1x protease inhibitor cocktail without EDTA from WAKO, 1x phosphatase inhibitor cocktail from Roche) containing 20 mM N-Ethylmaleimide to prevent further cysteine oxidation during protein extraction ...
-
bioRxiv - Cell Biology 2020Quote: Cells were harvested using a cell scraper and were lysed with 200 μl/well of 0.1% CHAPS lysis buffer (50 mM Tris-HCl, 150 mM NaCl and 1 mM EDTA) supplemented with a Mini Protease inhibitor cocktail (Roche). The cell lysate was incubated on ice for 15 mins with occasional mixing before centrifugation at 20,000 g at 4°C for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... The pellets were washed once with Buffer A and then further lysed with 250 μl modified RIPA buffer (1mM EDTA, 150mM NaCl, 0.1% Na-DOC, 1% NP-40, 50Mm Tris pH7.5 and Complete Roche protein inhibitors). 50U of benzonase (nuclease ...
-
bioRxiv - Cell Biology 2020Quote: ... The slides were allowed to air dry fully before applying Hybridizing Solution (70% formamide, 1 mg/ml blocking reagent (Roche), 10 mM Tris-HCl pH 7.2 ...
-
bioRxiv - Developmental Biology 2021Quote: Wildtype stain and drl:mCherry-positive zebrafish embryos were grown until tailbud stage and chorions were removed by incubating in 1 mg/mL Pronase (Roche), followed by washing in E3 medium ...
-
bioRxiv - Genetics 2021Quote: ... livers were perfused at low flow for approximately 10 min with Digestion Buffer (low glucose DMEM supplemented with 1 mM HEPES) containing freshly added Liberase TM (32 μg/mL; Roche). Digestion was stopped using Isolation Buffer (low glucose DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... and cells were washed twice in 1 ml Wash Buffer (20 mM HEPES-KOH pH 7.5; 150 mM NaCl; 0.5 mM Spermidine; 1x Roche cOmplete™), followed by addition of 10 µl pre-activated concanavalin A coated magnetic beads (Bangs Laboratories-BP531) ...
-
bioRxiv - Microbiology 2020Quote: Cell pellets of 1 × 106 cells were resuspended in 100 μl RIPA lysis buffer containing a protease inhibitor cocktail (Roche). Samples were centrifuged for 5 min to remove cell debris and stored at −20°C until use for Western blot analysis.
-
bioRxiv - Microbiology 2019Quote: ... The membrane was equilibrated in hybridisation buffer for 1 hour at 68°C in pre-warmed DIG Easy Hyb solution (Roche) in a rotating hybridisation oven ...
-
bioRxiv - Molecular Biology 2021Quote: ... exponentially growing cells were treated with DMSO or 1 μM PARPi for 24 h followed by 45 min incubation at 37°C with Colcemid (Roche). Metaphase preparation and aberration analysis were performed as it follows ...
-
bioRxiv - Developmental Biology 2021Quote: ... Digoxigenin- or fluorescein-labeled riboprobes were synthesized as described (Pearson et al., 2009) and detected with anti-digoxigenin-HRP (1:2000, Roche/Sigma-Aldrich 11207733910 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... sections were incubated in a 1:1000 dilution of alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics, Cat. No. 11207733910) then stained with nitro blue tetrazolium (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 0.1% Tween 20) for 5 min each and then incubated in the AP reaction buffer with NBT/BCIP substrate (Roche).
-
bioRxiv - Developmental Biology 2020Quote: Cells were lysed in TNT buffer (1% Triton X-100, 150 mM NaCl, 50 mM Tris HCl, pH 8) with protease inhibitors (Roche). 5 uL of whole cell lysate (approximately 40 μg ...
-
bioRxiv - Developmental Biology 2021Quote: ... The adult inner ears were first were decalcified with 120 mM EDTA for 2 days at 4°C until they were soft and ready for micro-dissecting out the cochlear sensory epithelium for use in whole-amount preparation and immunostaining with the following first antibodies: anti-HA (rat, 1:200, 11867423001, Roche), anti-Prestin (goat ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA-probe hybrids were detected by an alkaline phosphatase-conjugated antibody (Anti-Digoxigenin-AP or Anti-Fluorescein-AP, Fab Fragments, 1:5000, Roche, Cat# 11093274910 ...
-
bioRxiv - Genomics 2020Quote: ... cell pellets of approximately 1-5 million cells digested overnight at 50C in 500 μl lysis buffer containing 100 μg/ml proteinase K (Roche), 10 mM Tris pH 8.0 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Plant Biology 2022Quote: ... The ELVd probe was obtained via in vitro transcription of a linearized plasmid for 1 h at 37°C with 20 U of T3 bacteriophage RNA polymerase (Roche) in 40 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2022Quote: ... and lysed on ice for 15 minutes with 100 µl lysis buffer (50 mM HEPES, 150 mM NaCl, 1% TritonX100) supplemented with protease and phosphatase inhibitor cocktail (Roche). 10% of the soluble fraction of the lysate was boiled with 4X sample buffer ...
-
bioRxiv - Molecular Biology 2019Quote: Pellets from 2 ml cultures were resuspended in 500 μl SDS buffer (1% SDS, 10 mM EDTA, 5M Tris HCl, cOmplete Tablets Mini EDTA-free EASYpack (Roche), PhosSTOP (Roche)) ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: Immunological detection was performed using antidigoxygenin-AP Fab antibody fragments at a dilution of 1:2000 (Roche Diagnostics, Mannheim, Germany). After probe hybridization ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4×15cm plates of confluent WT F1 2-1 MS2129 female ESCs were lysed by pipetting in 3mL of lysis buffer (10M Tris-HCl pH8, 137mM NaCl, 1% NP40, 2mM EDTA) supplemented with 1x Complete EDTA-free Protease Inhibitors (Roche) and incubated for 1h on ice with or without RNase (10μg/mL RNase A ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.1% Triton X-100, pH 7.4, containing phosphatase inhibitors (10 mM NaF, 1 mM Na3VO4) and protease inhibitors (cOmplete®, Roche) and the protein concentration was adjusted to 2 mg/ml using the Bradford method (Thermo Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and were homogenised in TBS pH 7.4, 1% NP-40 containing phosphatase inhibitors (10mM NaF, 1mM Na3VO4) and protease inhibitors (cOmplete®, Roche). Protein concentration was adjusted to 10 mg/ml by the Bradford method (Pierce ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sequencing libraries were constructed from 1 ng of immunoprecipitated and input DNA using the KAPA Hyper Prep kit (KAPA Biosystems) and NEXTflex ChIP-seq barcodes (Bio Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... Eight million HEK293T cells were lysed with 800 μL cell lysis buffer (HBS, 0.1% NP-40, 5 mM EGTA, supplemented with 1 χ protease inhibitor cocktail [Roche, Cat.# 11873580001] ...
-
bioRxiv - Molecular Biology 2019Quote: Pellets from 75 ml cultures were resuspended in 500 μl SDS buffer (1% SDS, 10 mM EDTA, 5M Tris HCl, cOmplete Tablets Mini EDTA-free EASYpack (Roche), PhosSTOP (Roche)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nuclear pellets were lysed by sonication on ice in 10 mL lysis buffer (50 mM Tris pH 7.4, 0.5 M NaCl, 0.4% SDS, 5 mM EDTA, 1 mM DTT, 1x Roche complete protease inhibitor). After sonication ...
-
bioRxiv - Immunology 2022Quote: ... In short lungs were minced with scissors and incubated in a digestion cocktail containing 1 mg/mL collagenase A (Roche) and 30 μg/mL DNase I (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... cells were resuspended in 500 μl lysis buffer (10 mM Tris HCl, 10 mM NaCl, 0.3% NP40, 1× Roche Complete) and kept on ice ...
-
bioRxiv - Immunology 2021Quote: ... Colon tissue samples devoid of intra-epithelial cells as well as lung and skin samples were enzymatically digested with 1 mg/ml Collagenase A from Clostridium histolyticum (Roche) and 1 unit/ml DNaseI (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... PrPSc levels were determined through digestion of 20 μg of COCS homogenates with 25 μg mL-1 of proteinase K (PK, Roche) at a final volume of 20 μL in PBS for 30 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sense and antisense digoxigenin-labeled RNA probes were prepared from a BglII-digest of the pMPX2-1 mouse Pax6 cDNA clone (25) using a DIG RNA labeling kit (Roche). Hybridization and stringent posthybridization wash steps were performed at 65°C.
-
bioRxiv - Neuroscience 2019Quote: ... and incubated 2 hr at room temperature with a 1:5000 dilution of alkaline phosphatase-conjugated anti-DIG primary antibody in block solution (Roche, cat #11-082-736-103 ...