Labshake search
Citations for Roche :
5501 - 5550 of 6311 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Trichonympha and Teranympha cells were extracted from the hindgut of termites in 10 mM K-PIPES in the presence of cOmplete protease inhibitor cocktail (1:1000; Roche) as described (Guichard et al ...
-
bioRxiv - Biochemistry 2020Quote: ... His – tagged SARS-CoV2 S trimers were purified using a two-step purification protocol by 1 mL or 5mL cOmplete His-tag columns (Roche). Proteins were further purified by size-exclusion chromatography using a HiLoad Superdex 200 16/600column (GE Healthcare).
-
bioRxiv - Pathology 2021Quote: ... The sections were incubated for 1 to 24 hr in the dark at room temperature with development solution (NBT/BCIP substrate, Roche)
-
bioRxiv - Genetics 2021Quote: ... Probes were generated using primers listed in Supplementary Table 1 from the G135P65476A4 BAC as described in [8] and were labeled using the DIG-Nick Translation Mix (Roche) as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Tissues were incubated with primary antibody in dbe+ buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 2 mM EDTA, 1% BSA, 0.05% digitonin with Roche cOmplete protease inhibitor) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pelleted nuclei were resuspended in 1 ml ice cold shearing buffer (10 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% Na-Deoxycholate, 0.1% SDS, 1x Roche cOmplete protease inhibitors). Buffer compositions for LB1 ...
-
bioRxiv - Microbiology 2020Quote: ... 24 hours post infection cells lysed using NP-40 buffer (50 mM Tris, 150 mM NaCl, 1% Nonidet P-40, and Complete Mini protease inhibitor cocktail [Roche]). Insoluble material were removed by centrifugation ...
-
bioRxiv - Microbiology 2021Quote: ... 5% CO2 for 48h the cells were washed twice with PBS and then lysed in PBS/1% NP40 including the cOmplete protease inhibitor cocktail 2 (Roche) and phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Exon 1 and exon 3 digestion products were purified using the High pure PCR product purification kit (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... two volumes of RIPA buffer supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche Applied Science) was added to one volume of packed worms ...
-
bioRxiv - Genetics 2021Quote: ... cells were collected in lysis buffer (TBS + 1% Triton X-100) containing protease inhibitors (Complete Mini EDTA-Free, Roche 04693159001), briefly sonicated ...
-
bioRxiv - Immunology 2020Quote: Cell lysates from flow-sorted bone marrow osteoclast progenitors grown in presence of M-CSF and RANKL over time were harvested in 1% NP40 lysis buffer containing 1X cOmplete Protease Inhibitor cocktail (Roche). Samples were separated by SDS-PAGE and transferred to nitrocellulose membrane ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with BaseMuncher nuclease (Expedion; 1 ml per 40 ml cell suspension) and Complete EDTA-free protease inhibitor mix (Roche). The extract was precleared by centrifugation ...
-
bioRxiv - Microbiology 2021Quote: ... the parasites were re-suspended in 1xPBS containing 1 mg/ml soybean trypsin inhibitor and 25x protease inhibitor cocktail (Roche) before the parasites were pelleted and lysed in lysis buffer (4% SDS ...
-
bioRxiv - Developmental Biology 2020Quote: ... and blocked in 10% Sheep Serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST / 1% sheep serum overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 mM NaF and 1 mM Na3VO4) in the presence of complete EDTA-free protease inhibitor cocktail (Roche Life Science) for 20 min at 4°C ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Physiology 2020Quote: ... Sections were then dried and covered in an alkaline phosphatase (AP)-conjugated anti-DIG antibody (1:3000; Roche, Mannheim, Germany) in buffer B1/2.5% goat serum at 4°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... gDNA regions were amplified via PCR using 1/150th gDNA and 300nM forward and reverse primers in a 50 μL FastStart PCR Master Mix reaction (Roche). PCR products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: Round spermatids enriched by STA-PUT were lysed with 1% Triton X-100 in PBS supplemented with EDTA-free protease inhibitor cocktail (Roche) by gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein aggregation was evaluated by western blot in total cell extracts prepared in 1% Triton X-100 in PBS containing proteases and phosphatases inhibitors (Roche). Sample quantification was performed with the Pierce BCA Protein Assay Kit (Thermo Scientific).
-
bioRxiv - Cancer Biology 2021Quote: ... and 5% glycerol with the addition of 1 EDTA-free cOmplete protease inhibitor cocktail tablet per 50 mL lysate (Roche). Cells were lysed by sonication on ice with stirring and the lysates were clarified by centrifugation at 20,000 g for 30 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: Harvested cells were resuspended in lysis buffer (50mM Tris-Cl pH 7.5, 150mM NaCl, 1mM MgCl2, 1% NP40) supplemented with protease inhibitor (Roche 11836170001) and phosphatase inhibitor cocktail (Sigma P5726 ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were washed with cold 1x PBS three times and before scrapping the samples in cold lysis buffer (50 mM Tris pH 7.6, 200 mM NaCl, 1% Triton X-100, 0.5% CHAPS + complete protease inhibitor/Roche Cat# 11836153001). The samples were mechanically disrupted by passing them through a 27.5 syringe five times before sonication on ice (1 sec on ...
-
bioRxiv - Microbiology 2021Quote: ... the trachea was catheterized and BAL was performed by 2 consecutive flushes of the lungs with 1 mL ice-cold PBS containing Complete Protease Inhibitor Cocktail (Roche). Cell density in BAL fluid (BALF ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue was homogenized by probe sonication at 20kHz for 10s in ice-cold TBS buffer (tris-buffered saline, 1% Triton X-100; pH 7.4) containing protease inhibitor (Roche 11697498001) and phosphatase inhibitor (Sigma 4906845001 ...
-
bioRxiv - Neuroscience 2021Quote: ... Both NIB and IP Buffer were supplemented with an EDTA-free cOmplete protease inhibitor cocktail tablet (1 tablet/28 ml; 11873580001, Roche) and RNasin Plus RNase inhibitor (0.2% ...
-
bioRxiv - Genetics 2021Quote: Animals were resuspended in lysis buffer (50 mM Tris/HCl pH 7.4, 100 mM NaCl, 1% v/v SDS, complete protease inhibitor cocktail (Roche Diagnostics)) ...
-
bioRxiv - Immunology 2021Quote: ... 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.1% SDS and 1%Triton X-100 and protease inhibitors cocktail (Mini-Complete EDTA-free; Roche Applied Science, Penzberg, Germany). Lysates were centrifuged (13000g ...
-
bioRxiv - Neuroscience 2021Quote: Dissected brain regions of interest or culture samples were homogenized with TX-soluble buffer (50 mM Tris [pH 8.0], 150 mM NaCl, 1% Triton-X 100) containing protease and phosphatase inhibitors (Roche, USA). The supernatants were collected for soluble fraction after centrifugation (20 ...
-
bioRxiv - Biochemistry 2021Quote: Cells confluent in a 15-cm dish were washed by PBS buffer three times before being lysed on plate with 1 mL ice-cold NP-40 lysis buffer supplemented with protease inhibitor cocktail (Roche) and PhosSTOP (Roche) ...
-
bioRxiv - Cancer Biology 2020Quote: ... minced with a sterile scalpel in a petri-dish containing complete medium (DMEM/10%FBS/2mM L-Glutamine/1x NEAA/1x Sodium Bicarbonate/10mM HEPES/ 1x Pen/Strep) and then incubated with complete medium containing 1 mg/ml Collagenase P (Roche) for 90 minutes at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... The cultures were spun down and cell pellets were resuspended in 500 μL of Workman Extract Buffer (40mM HEPEs pH7.4, 250mM NaCl, 0.1% NP40, 10% Glycerol, 1 mM PMSF, Roche proteinase inhibitors). 250 μL of glass beads were added and cells were lysed with Peqlab precellys homogenizator (3×30 sec) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science ...
-
bioRxiv - Bioengineering 2020Quote: ... Hela cells were plated one day before in 6-well plate at 50% confluency and transfected with 1 μg plasmid and 3 μl XtremeGeneHP transfection reagent (Roche) during 24 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% Blocking reagent + 20% Goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Roche) in the blocking buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... digested using 0.1 % papain at 37°C for 10 min and for 5 additional minutes in presence of DNAse1 (1 mg/ml, Roche). After stopping papain activity by adding MC+ media ...
-
bioRxiv - Microbiology 2021Quote: ... Radiolabeled probe was generated by purifying a digested (Ncol; 1 cut) pCpG vector DNA using High Pure PCR product Purification Kit (Roche) followed by radiolabeling the probe using Random Prime DNA labeling kit (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were lysed using the same lysis buffer as used for the ribosome profiling experiment with 1× protease inhibitor cocktail (Roche), omitting cycloheximide ...
-
bioRxiv - Immunology 2020Quote: ... was amplified from cDNA using primers mPodoHindFor (GATCAAGCTTATGTGGACCGTGCCAGTGTTG) and mPodoFcRev (GATCGGATCCACTTACCTGTCAGGGTGACTACTGGCAAGCC) and was quantified by SYBR Green 1 mastermix (Roche) qPCR using a PCR thermocycler and normalised to unstimulated control.
-
bioRxiv - Immunology 2020Quote: ... were cut into small pieces with a scalpel and incubated in a Collagenase D (1 mg/ml)/ of DNase I (70 μg/ml) enzymatic cocktail (Roche) in RPMI ...
-
bioRxiv - Immunology 2020Quote: ... mouse thymus was collected and homogenized in 1 ml of cold PBS containing cOmplete protease inhibitor cocktail (Roche, Indianapolis, IN) using a tissue homogenizer (Omni International ...
-
bioRxiv - Immunology 2020Quote: ... The mucosa was stripped and dissociated in GentleMACS tubes in digestion medium (DM; complete medium (RPMI 1640 with PGA/L-glutamine/10% FCS) with 1 mg/mL Collagenase D (Roche), 1 mg/mL soybean Trypsin inhibitor (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and protein extracted using RIPA buffer with protease inhibitor cocktail mix (1 Complete MINI EDTA-free protease inhibitor tablet (Roche), 25 μg/mL calpain inhibitor (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... The lymphocytes from the immunized mice were fused with myeloma P3U1 cells at a ratio of 3:1 by mixing in 50% polyethylene glycol (Roche). The fused cells were dispersed in 80 ml of GIT medium (Wako ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel pieces briefly rinsed with 50 mM AmBic and rehydrated in a small volume (10 μL) of 50 mM AmBic supplemented with 1 U PNGase F (Roche) at 37 °C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... LNs were sliced into small pieces and digested for 30 min at 37°C in collagenase D (1 mg/ml, Roche). For DC-T conjugate analysis by flow cytometry and ImageStream ...