Labshake search
Citations for Roche :
501 - 550 of 6519 citations for Somatostatin Receptor 1 SSTR1 Rabbit Polyclonal affinity purified Alexa488 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... DNA was purified using High Pure PCR Purification Kit (Roche) and concentrations were quantified by Qubit (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... purified on High Pure PCR Product Purification Kit columns (Roche) and eluted in water ...
-
bioRxiv - Immunology 2023Quote: ... digested and purified plasmid was dephosphorylated (rAPid Alkaline Phosphatase) (Roche) and used in a Gibson Assembly reaction together with the purified PCR products ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and purified using cOmplete His-Tag Purification Resin (Roche, Switzerland) and His-Bind Purification kit (Novagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA was purified using the RNA purification kit (Roche). qRT-PCR were performed following the manufacturer’s instructions for the iTaq™ Universal SYBR® Green One-Step Kit (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... samples were purified using 1X KAPA Pure beads (KAPA Biosystems) and PCR amplified using the KAPA HiFi HotStart ready mix (KAPA Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified with quick spin RNA columns (Roche, Indianapolis, IN). Biotin-labeled RNA or unbiotinylated RNAs was dissolved in RNA structure buffer (10 mM Tris ...
-
bioRxiv - Microbiology 2024Quote: ... Barcoded libraries were purified using KAPA Pure Beads (Roche, Switzerland). Library concentrations were measured using the Quant-iT dsDNA Assay Kit ...
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2021Quote: ... Antisense DigoxigeninUTP-labeled RNA probes were synthesized at 37°C using RNA DIG labeling mix per manufacturer’s instructions (Roche) using RNA polymerase ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dig-labeled sense and antisense RNA probes for vasa were prepared as described previously [24] (Ambion AM1310, Roche 11277073910). Probes were diluted to 2ng/μL in 100% hybridization solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pax3 digoxigenin (DIG) - labeled antisense riboprobes were transcribed from linearized gene-specific probes (PCR DIG probe Synthesis Kit, Roche). WISH experiment was performed as follows ...
-
bioRxiv - Developmental Biology 2019Quote: ... The digoxigenin-labeled RNA probes were prepared using a DIG RNA labeling kit according to the manufacturer’s protocol (Roche) using each cDNA clone as the template ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1X Denhardt solution) containing 1μg/ml DIG labeled RNA probes (prepared with a DIG RNA labeling mix, Roche, 11277073910) for overnight at 65°C in a humid chamber ...
-
bioRxiv - Cell Biology 2022Quote: ... The labeled cells were directly harvested in 1ml of RIPA buffer including 1X EDTA-free protease inhibitor cocktail (Roche). The lysate was cleared by centrifugation at 20,000g for 15 min ...
-
bioRxiv - Genomics 2022Quote: ... The BAC clone (MSMg01-38O12) was labeled by nick-translation with biotin-16-dUTP (Cat# 11093070910, Roche Applied Science) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIG-labeled probes where generated using T7/SP6 transcriptions start sites and the digoxigenin RNA Labeling Mix kit (Roche) after manufactures instructions ...
-
bioRxiv - Genetics 2022Quote: ... Total Ty1-copia sequences labeled with DIG were prepared as probes using the PCR-DIG Probe Synthesis Kit (Roche). ImageJ and Calculator software (http://cels.uri.edu/gsc/cndna.html ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sense and antisense riboprobes were transcribed from linearized plasmids and labeled with digoxigenin (DIG RNA-labelling reagents, Roche Biochemicals). Primers used to amplify zebrafish nhsb were 5’ tgatctaccttttctcccatgccatt 3’ and 5’ tctcacacaccacagaggctcca 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense and sense digoxogenin (DIG)-labeled RNA probes were generated using the DIG RNA labeling kit (Roche Diagnostics, Germany), following the manufacturer’s instructions ...
-
Zbtb14 regulates monocyte and macrophage development through inhibiting pu.1 expression in zebrafishbioRxiv - Developmental Biology 2022Quote: ... The probes labeled by digoxigenin were detected using alkaline phosphatase coupled anti-digoxigenin Fab fragment antibody (Roche, Basel, Switzerland) with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories ...
-
bioRxiv - Genetics 2023Quote: ... The antisense probe for wdr31 was then transcribed with digoxigenin-labeled UTPs and T7 RNA polymerases (Roche, Basel, Switzerland). The stained embryos were dehydrated in glycerol and photographed with a Nikon SMZ1500 stereomicroscope (Nikon ...
-
bioRxiv - Genomics 2023Quote: ... accession numbers OY726585 and OY726586) were indirectly labeled by PCR in the presence of biotin-16-dUTP (Roche Diagnostics) detected by streptavidin-Cy3 (Sigma–Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... In situ hybridization was performed as previously described19 with custom anti-sense DIG-labeled riboprobes transcribed in vitro (Roche) from amplified cDNA (see Key Resources Table for primers) ...
-
bioRxiv - Developmental Biology 2023Quote: ... We synthesized digoxigenin (DIG)-labeled sense and antisense RNA probes using a DIG RNA Labeling Kit (Roche, Basel, Switzerland) after digestion with the appropriate restriction enzymes BamHⅠ-HF ...
-
bioRxiv - Developmental Biology 2023Quote: ... The resulting PCR product was used to synthesize in situ probe by the addition of DIG-labeled UTP (Roche) plus the appropriate RNA Polymerase T7 or Sp6 (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and used to produce the DIG-labeled single-stranded RNA probes using the DIG RNA labeling kit (Roche, #11175025910). Probes were then cleaned with MegaClear Kit (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by rabbit anti-Rat (AI-4001, Vector) at 1:500 for 32 min and OmniMap™ anti-Rb HRP (760-4311, Roche). Blocking was performed using casein (760-219 ...
-
bioRxiv - Microbiology 2020Quote: ... and further purified using the High Pure RNA Isolation kit (Roche). RNA quantity was assessed using the Quant-iT RiboGreen RNA Assay kit (Invitrogen) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and purified using an automated MagNA Pure 96 system (Roche Diagnostics). The total RNA was quantified using the Qubit RNA Assay Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cell lysate was first purified using Ni-NTA beads (Roche) and then subjected to size-exclusion chromatography on HiLoad Superdex 200 16/600 column (GE Healthcare ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was purified using High Pure PCR Product Purification Kit (Roche), according to the recommendations of the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... and purified using quick spin columns (Roche 11-273-949-001). Membranes were pre-hybridized for 1 hr with Church buffer at 55°C ...
-
bioRxiv - Biochemistry 2020Quote: ... then purified with a High Pure PCR Product Purification Kit (Roche). Following this ...
-
bioRxiv - Developmental Biology 2022Quote: ... sgRNAs were purified using High Pure PCR Cleanup Micro Kit (Roche). Concentration of sgRNAs was measured by Nanodrop (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... The purified RNA was treated with DNase I (RNase-free, Roche) and used to produce oligo dT-primed cDNAs (SuperScript II RT ...
-
bioRxiv - Genomics 2021Quote: ... libraries were purified using High Pure PCR Product Purification Kit (Roche), followed by a second purification with Agencourt AMPure Kit to fully remove primers and small fragments ...
-
bioRxiv - Immunology 2021Quote: ... and 0.2mg/ml Liberase CI purified enzyme blend (Roche Diagnostics Corp.), and incubated for 1–2hours at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... and purified using a PCR purification kit (Roche, Upper Bavaria, Germany). Linearized plasmids were used as templates for the in vitro transcription reaction using the T7 MegaScript kit ...
-
bioRxiv - Physiology 2022Quote: ... SPRI-bead purified with KapaPure beads (Kapa Biosystems / Roche, Basel, Switzerland), quantified via qPCR with a Kapa Library Quant kit (Kapa Biosystems ...
-
bioRxiv - Physiology 2022Quote: ... SPRI-bead purified with KapaPure beads (Kapa Biosystems / Roche, Basel, Switzerland), quantified via qPCR with a Kapa Library Quant kit (Kapa Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... SPRI-bead purified with KapaPure beads (Kapa Biosystems / Roche, Basel, Switzerland), and quantified via qPCR with a Kapa Library Quant kit (Kapa Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... SPRI-bead purified with KapaPure beads (Kapa Biosystems / Roche, Basel, Switzerland), and quantified via qPCR with a Kapa Library Quant kit (Kapa Biosystems ...
-
bioRxiv - Physiology 2022Quote: ... The purified RNA was treated with DNase I (RNase-free, Roche) and used to produce oligo dT-primed cDNAs (SuperScript II RT ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicons were purified using High Pure PCR Product Purification Kit (Roche). Primers are listed in Table S5.
-
bioRxiv - Microbiology 2023Quote: ... The target protein was purified using His-Tag Purification Resin (Roche) according to the manufacturer instructions.
-
bioRxiv - Microbiology 2024Quote: ... and purified with the High Pure PCR product purification kit (Roche). Sequencing indexes were added by LGC ...
-
bioRxiv - Microbiology 2023Quote: ... Purified libraries were quantified using the Kapa Library Quantification Kit (Roche), pooled in equimolar concentrations ...