Labshake search
Citations for Roche :
751 - 800 of 6519 citations for Somatostatin Receptor 1 SSTR1 Rabbit Polyclonal affinity purified Alexa488 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... for CD31 or OmniMap anti-Rabbit HRP (Roche, 760-4311) and the DISCOVERY ChromoMap DAB kit (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... and human Ki67 rabbit monoclonal antibody (Roche Diagnostics, 790-4286). Images were captured with VENTANA iScan HT (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2023Quote: ... or incubation with OmniMap Rabbit HRP antibody (760-4311, Roche) and ChromoMap DAB (760-159 ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were purified using the High Pure PCR product Purification Kit (Roche, Denmark). Subsequently the purified PCR products were sent for sequencing at LGC Genomics (Berlin ...
-
bioRxiv - Genetics 2019Quote: ... Purified DNA was analysed by quantitative PCR using Roche Lightcycler480 using SYBR green reagents (Roche). The following primers were designed to assess luciferase plasmid concentrations to normalise transfection efficiencies (LucChIP for;CTTGCAGTTCTTCATGCCCG ...
-
bioRxiv - Developmental Biology 2019Quote: ... Newly synthesized probes were purified using mini QuickSpin columns according to the manufacturer’s protocol (Roche). Synthesis of RNA probes was performed as described (North et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... the library fragments were purified with KAPA Pure Beads system (KAPA Biosystems, Roche, Basel, Switzerland). The library carrying appropriate adapter sequences at both ends was amplified using KAPA HiFi HotStart ReadyMix (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... the library fragments were purified with KAPA Pure Beads system (KAPA Biosystems, Roche, Basel, Switzerland). The library carrying appropriate adapter sequences at both ends was amplified using KAPA HiFi HotStart ReadyMix (KAPA Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was purified using the High Pure PCR Product Purification Kit (Roche, Germany) and subjected to electrophoresis in 1% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR amplicon was purified using the High Pure PCR Product Purification Kit (Roche, Germany) to remove the contaminants and the amplicon was sequenced with forward and reverse primers using Big Dye Terminator v3.1 Cycle Sequencing kit on Applied Biosystems 3730 x l Genetic Analyzer ...
-
bioRxiv - Neuroscience 2021Quote: Purified immunopanned OPCs were rinsed with chilled PBS containing 1x PhosSTOP (Sigma-Aldrich-Roche, 4906845001) and 1x halt protease inhibitor cocktail (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was purified from buccal cells using a MagNA Pure96 robot (Roche Diagnostics, Mannheim), sample probes were designed by TIB MolBiol (Berlin ...
-
bioRxiv - Developmental Biology 2021Quote: ... His-tagged proteins in soluble fraction were purified using cOmplete His-Tag Purification Columns (Roche). The columns were washed with 10 column volumes of wash buffer 1 (20 mM Tris ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and purified in large volume columns (High Pure Viral Nucleic Acid Large Volume Kit, Roche) using 2.5 ml of PB buffer ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... Expressed proteins were subsequently purified using a cOmplete His-Tag Purification column (1mL column, Roche) and SEC (S200 ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Immunology 2020Quote: ... placed in DMEM containing 0.2 mg/mL Liberase Cl purified enzyme blend (Roche Diagnostics Corp.), and incubated for 1.5 hr at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified libraries were quantified using the KAPA library quantification kit (Kapa Biosystems, Wilmington, MA, USA) as per manufacturer’s instructions performed on an Applied Biosystems 7500 Fast real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were purified using the High Pure PCR Production Purification Kit (11732676001, Roche / Sigma-Aldrich). Libraries were validated on an Agilent 2100 and quantified using quantitative PCR (Q-PCR) ...
-
bioRxiv - Plant Biology 2023Quote: ... Libraries were prepared with the purified PCR product by the Kapa DNA Hyper Kit (Roche) together with TruSeq DNA UD indexes for Illumina (Illumina ...
-
bioRxiv - Physiology 2022Quote: ... The cDNA was ultimately purified using AMpure XP beads and quantified by qPCR assay86 (Roche Light Cycler 480 Instrument II ...
-
bioRxiv - Immunology 2023Quote: ... Amplified DNA libraries were purified by adding 1.3x volume of KAPA pure SPRI beads (Roche) to each sample and incubated for 10 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... supernatants were harvested and purified using His-Tag purification resin (Roche, cOmpelteTM, Cat No.5893682001), followed by size-exclusion chromatography in 20 M Hepes or Tris pH 8 ...
-
bioRxiv - Developmental Biology 2020Quote: ... either SP6 or T7 RNA polymerase was used to produce a DIG (digoxigenin)-labeled RNA anti-sense probe (Roche DIG RNA Labelling Kit (SP6/T7)) ...
-
bioRxiv - Genetics 2020Quote: ... A LYS2 probe was amplified and labeled with Digoxigenin (DIG)-dUTP using the primers 5’-TGAAGCCTTCCCAGAGAGAA and 5’-GCCAAGGAAAAATGTCTACCA (Roche PCR DIG Probe Synthesis Kit). The DIG probe was hybridized to the membrane (at 44°C ...
-
bioRxiv - Neuroscience 2023Quote: The digoxigenin-labeled antisense riboprobe was synthetized using the DIG RNA Labeling mix with the T3 RNA polymerase (Roche Diagnostics, cat. no. 11 031 171 001) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Coimmunolocalization was performed with a rabbit anti GFP primary antibody (Roche) and appropriate combination of Alexa-conjugated secondary antibodies (Invitrogen).
-
bioRxiv - Cancer Biology 2019Quote: ... c-Myc (RTU; rabbit, #790-4628, clone Y69; Roche, Basel, Switzerland), phospho-RPA32 (Ser33 ...
-
bioRxiv - Microbiology 2021Quote: ... Discovery OmniMap anti-Rabbit HRP (Roche Tissue Diagnostics cat# 760-4311), and Discovery OmniMap anti-mouse HRP (Roche Tissue Diagnostics cat# 760-4310) ...
-
bioRxiv - Immunology 2020Quote: ... The OmniMap anti rabbit HRP kit (760-4311, Roche Diagnostics, UK) was used to detect the antibodies of interest ...
-
bioRxiv - Developmental Biology 2021Quote: ... The final enriched product (library, after PCR) was purified using KAPA purification beads (Roche 07983298001 - KK8002) and a dual-SPRI size selection was performed (with KAPA beads ...
-
bioRxiv - Genomics 2020Quote: ... concentrators and purified in large volume columns (High Pure Viral Nucleic Acid Large Volume Kit, Roche) using 10X (2.5 ml ...
-
bioRxiv - Microbiology 2021Quote: ... spanning the SARS-CoV-2 genome) were purified using Kapa HyperPure beads (Roche Molecular Systems Inc) and quantified using a Qubit fluorometer and dsDNA HS Assay Kit (Thermo Fisher Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Gel-purified indexed libraries were quantified using the KAPA library quantification kit (Kapa Biosystems, Wilmington, MA) using an Applied Biosystems 7500 real-time PCR machine ...
-
bioRxiv - Molecular Biology 2022Quote: ... cell culture supernatants were harvested and proteins were purified from the supernatants using tandem Ni2+ (Roche) and Strep-Tactin (IBA ...
-
Physiological Substrates and Ontogeny-Specific Expression of the Ubiquitin Ligases MARCH1 and MARCH8bioRxiv - Immunology 2021Quote: ... cDC were purified from spleens of Flt3L-expanded mice following spleen digestion with DNase I (Roche) and collagenase type III and Nycodenz® density gradient centrifugation (Axis shield ...
-
bioRxiv - Cell Biology 2021Quote: ... The barcoded libraries were purified and quantified using the Library Quantification Kit - Illumina/Universal (KAPA Biosystems) on a TaqMan 7500 RealTime PCR System ...
-
bioRxiv - Cancer Biology 2022Quote: ... Purified libraries were normalized by quantitative PCR (qPCR) using the KAPA Library Quantification Kit (KAPA Biosystems) and diluted to a final concentration of 10 nM ...
-
bioRxiv - Molecular Biology 2022Quote: ... The purified pool was quantified by real-time PCR with the Kapa Biosystems Quantification Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... The purified PCR products were used to construct libraries by the Kapa DNA Hyper Kit (Roche) together with TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... The purified library was quantified using the KAPA library quantification kit (KAPA Biosystems, Wilmington, MA, USA) and sequenced on an Illumina Miseq platform (Illumina Inc ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acids were purified from whole blood or serum using the MagNA Pure 96 system (Roche) with the DNA/Viral NA 2.0 kit and the Viral NA Plasma external lysis S.V ...
-
bioRxiv - Plant Biology 2023Quote: ... The purified PCR products were prepared for the libraries using the Kapa DNA Hyper Kit (Roche) utilizing indexes from TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Physiology 2024Quote: ... The purified cDNA fragments were transcribed in vitro using T7 or SP6 RNA polymerase (Roche Diagnostics) in the presence of digoxigenin (DIG)-UTP ...
-
bioRxiv - Microbiology 2023Quote: ... were pooled and the amplicons of ∼450 bp were purified from 1.5% agarose (MP Roche, Germany) gel using the Wizzard SV Gel and PCR clean system (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting cDNA was purified using the High Pure PCR Product Purification Kit (Roche Applied Science) [44].
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was purified from one million cells with the High Pure RNA Isolation kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified library was purified and then quantified using KAPA library quantification kit (#07960255001, Roche, Basel, Switzerland) and Bioanalyzer (Agilent technologies) ...
-
bioRxiv - Biochemistry 2022Quote: Reverse transcription and PCR were performed on 2µg of purified RNA using the Transcriptor Reverse Transcriptase (Roche). RNA was first subjected to DNAse (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... and msp300-Cy5 RNA was purified using a Sephadex G50 spin column (Roche miniQuick Spin RNA column), followed by EtOH precipitation ...