Labshake search
Citations for Roche :
451 - 500 of 8504 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... S-phase Synchronous HeLa S3 cells were washed with ice-cold 1× PBS and lysed in a swelling buffer (20 mM HEPES, pH 7.5, 2 mM MgCl2, 5 mM KCl, 1 mM Dithiothreitol [DTT], and protease inhibitor cocktail [Roche; #11836170001]) supplemented with energy-regenerating mixture ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... pH 7.4) for 30 min and subsequently incubated 1 h with anti-HA-peroxidase high-affinity monoclonal rat antibody (3F10; Roche [catalog no. 12013819001]) diluted 1:1000 in 2.5% (w/v ...
-
bioRxiv - Biochemistry 2020Quote: ... the expression medium containing the secreted fusion protein was supplemented with 1/4 tablet of protease inhibitor (complete EDTA-free protease inhibitor cocktail tablets, Roche Diagnostic GmbH, 45148300) and transferred to a 15 ml Falcon tube containing 200 μl of washed ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were incubated overnight at 4 °C in MABB with anti-fluorescein POD (Roche) at a 1:500 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% V/V glycerol and Complete Mini Protease inhibitor cocktail tablets (Roche, Basel Switzerland), 1 tablet in 10 mL) ...
-
bioRxiv - Pathology 2021Quote: ... Obex samples had 4 µl of 1000 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the mutants were extracted with PBS containing 4 mM digitonin and protease inhibitors (Roche).
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then incubated overnight at 4°C with an anti-GFP (ROCHE Anti-GFP ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM DTT and 10 % (v/v) glycerol) supplemented with: cOmplete protease inhibitor (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4 °C in MABB with anti-DIG POD (Roche) at a 1:1,000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was reverse-transcribed using 2.5×10-4 U/μl hexanucleotide mix (Roche), 0.4mM deoxynucleotide mix (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested with digestion buffer (Gibco DMEM/F12, Fisher 11320033; 4 µg/ml Roche Collagenase/Dispase ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were blocked in blocking buffer comprised of 4% Bovine Serum Albumin (Roche, 10735087001) and 1% Triton X-100 in 1X PBS for 30 minutes at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg.kg-1 midazolam (Dormicum, Roche), and 0.05 mg.kg-1 fentanyl (Fentanyl ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Immunology 2023Quote: ... Cationic lipid N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate (Dotap, Liposomal Transfection Reagent, Cat#1202375, Roche, Nonnenwald, Penzberg, Germany) was used for the conjugation of phosphorothioated miRNAs and Dotap-formulated miRNAs were used for in vitro delivery of miRNAs ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Neuroscience 2020Quote: ... 40 mM KCl, 5 mM EGTA, 5 mM MgCl2, 5 mM DTT, 1 mM PMSF, 1% Triton X, protease inhibitor Roche complete, pH 7.2) and sonicated at low power for 5 s ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets of harvested bacteria were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Neuroscience 2020Quote: ... Then embryos were incubated for 2 hours in 5% Blocking Reagent (Roche) in MAB (150 mM maleic acid ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM 2-mercaptoethanol and cOmplete Protease Inhibitor Cocktail (Roche, no. 11697498001). The cell suspension was subjected to sonication (Qsonica ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Systems Biology 2021Quote: The digested lysates were mixed 1:1 with 2x IP buffer (200 mM Tris, pH 8.0; 600 mM NaCl; 4% Triton X-100; 2x Roche Complete EDTA-free protease inhibitors), and then kept on ice for no more than a few hours prior to antibody addition ...
-
bioRxiv - Physiology 2022Quote: ... This was followed by a perfusion at 4 mL/min for 40 min with the same solution containing 1 mg/mL of collagenase A (Roche Diagnostics GmbH, Mannheim, Germany) plus 300 µM ethylene glycol tetraacetic acid (EGTA ...
-
bioRxiv - Developmental Biology 2021Quote: ... Probes were hybridized at 56°C overnight and subsequently detected by anti-DIG at 4°C overnight (1:1000; Roche 11-207-733-910) with secondary tyramide signal amplification for 2h at room temperature in the dark (AKOYA Biosciences ...
-
bioRxiv - Zoology 2024Quote: ... Samples were pre-incubated for 2 h in blocking solution (25% deactivated goat serum in PBT) and incubated overnight at 4°C in blocking solution with anti-DIG antibody conjugated to alkaline phosphatase (Roche Diagnostics, Germany; 1:2000). After several washes in PBT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)) supplemented with 1X protease inhibitor cocktail (Complete; Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Developmental Biology 2021Quote: ... They are incubated for at least 4 hours in blocking solution 1x WBR (Roche, 11921673001) and incubated overnight at 4°C with anti-Digoxigenin antibody coupled to alkaline phosphatase (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: For sequencing all samples were treated with 4 mg/ml of proteinase K (Roche Diagnostics). RNA and small RNA were extracted and enriched in separate fraction from the supernatants using the mirVana kit according to manufacturer’s instructions to separate samples into two groups ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 μL of the supernatant were incubated with 20 μg/mL proteinase K (PK; Roche) in a total volume of 22 μL RIPA buffer for 1 hr at 37°C to digest all proteins except for PK-resistant PrPSc ...
-
bioRxiv - Neuroscience 2023Quote: ... and visualized after incubation with substrate solution containing NBT (4-nitro blue tetrazolium, Roche 11383213001) and BCIP (5-bromo-4-chloro-3-indolyl-phosphate ...
-
bioRxiv - Developmental Biology 2023Quote: ... embryos were fixed in freshly made 4% PFA in PBS with PhosSTOP™(Roche, 4906845001) overnight at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated overnight at 4°C in horseradish peroxidase-coupled anti-DIG antiserum (11207733910, Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were lysed at 4°C in RIPA buffer supplemented with protease inhibitors (Roche, 4693159001). Protein concentrations were measured using a BCA Assay Kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were then washed 4 times in wash buffer containing 25% formamide (Roche, 11814320001), 2x SSC (Ambion ...
-
bioRxiv - Developmental Biology 2022Quote: ... The sections were deparaffinized and rehydrated before digestion with proteinase K (4 μg/ml; Roche) for 15 min at 37℃ ...