Labshake search
Citations for Roche :
701 - 750 of 8504 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Embryo extracts were pre-cleared with empty beads equilibrated in IPP 150 for 30 min at 4°C in the presence of 1x complete protease inhibitor cocktail (Roche). Pre-cleared extracts (300-500 µg ...
-
bioRxiv - Microbiology 2021Quote: Wildtype genes were amplified by PCR from JE2 genomic DNA using the primers shown in table 4 and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using KpnI and SacI restriction sites and T4 DNA ligase (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Cell Biology 2020Quote: ... Pelleted tissue was weighted and resuspended in the enzymatic digestion mix composed by 2,4 U/ml dispase II (4 ml/g of muscles) (Roche 04942078001) dissolved in Dulbecco’s phosphate buffered saline (D-PBS ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were subsequently diluted by adding 150 μL of water and 4 μL was used for RT-qPCR performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... total cellular protein extracts were obtained by lysing cells for 30 min at 4°C in lysis buffer (Pierce RIPA Buffer) in the presence of protease inhibitors (cOmplete Protease Inhibitor Cocktail, ROCHE). Samples were centrifuged for 20 min at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Biochemistry 2022Quote: ... Three biological replicates of sRNA from infected and noninfected MT-4 cells and cDNA samples after NAD captureSeq were measured in two technical repeats on LightCycler 480 II (Roche) by Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Matrigel drops (at least 4 samples per time point) were first digested with HBSS solution containing 10 U/ml dispase II (Roche) and 125 U/ml collagenase type IV (Gibco ...
-
bioRxiv - Molecular Biology 2022Quote: ... and lysed by 4 freeze/thaw cycles in the presence of 1mM PMSF and cOmplete protease inhibitor cocktail tablet (Roche). Lysates were clarified by centrifugation at 39,000xg for 1.5hrs ...
-
bioRxiv - Molecular Biology 2022Quote: ... UV cross-linked (1200J/m2) and hybridized with a DIG-labelled (GCCTAA)4 probe at 37°C using DIG Easy Hyb (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... dissociated with an equal mixture of 4 mg/ml of collagenase D and dispase II (Roche Applied Science, Indianapolis, IN) and cultured in F-12K (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... The structure of the lacO–tetO reporter locus was checked by a set of 4 PCRs using Expand Long Template PCR System (Roche) and the following primer pairs ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... centrifuged for 5 min at 1000 rpm and stored at 4 °C until measurement for LDH activity according to the manufacturers protocol (Roche, LDH Cytotoxicity Detection Kit ...
-
bioRxiv - Neuroscience 2024Quote: ... Whole mount larvae and adult brain sections layered on glass slides were blocked for at least one hour in PBT with 2 mg/ml bovine serum albumin and 2% sheep serum at room temperature and then incubated overnight at 4°C with alkaline phosphatase-coupled anti-DIG antiserum (11093274910, Roche) diluted 1/5000 in blocking solution ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting supernatants were incubated for 16 h while rotating at 4°C with 8 µg/ml anti-GFP antibody (Roche). Protein A/G PLUS-Agarose (Santa Cruz ...
-
bioRxiv - Cell Biology 2023Quote: Cells were lysed in SDS lysis buffer (4% SDS, 20% glycerol, 125 mM Tris-HCl pH=6.8) supplemented with protease inhibitors (cOmplete ™ Mini (Roche)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase activity was detected in the dark in AP buffer supplemented with 45 mg/ml 4-nitrobluetetrazolium chloride (NBT, Roche) and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were blocked for 30 minutes in 1% Roche Western Blocking Reagent prior to incubating overnight at 4°C with either anti-FITC with horseradish peroxidase conjugate (Roche) at a 1:2000 concentration or anti-DIG-with horseradish peroxidase conjugate (Roche ...
-
bioRxiv - Neuroscience 2023Quote: Pools of 2 to 4 organoids were resuspended in cold lysis buffer (Cell Signalling Technology) supplemented with protease and phosphatase inhibitor cocktails (Roche) and sonicated twice for 3 seconds at 10% intensity in the Branson digital Sonifier SFX 150 (Emerson) ...
-
bioRxiv - Neuroscience 2024Quote: ... Slides were then incubated overnight at 4°C in 0.1% goat serum with 0.05% alkaline phosphatase-conjugated DIG antibodies (Roche Cat # 11093274910) and washed before development was carried out using detection buffer containing 20 μL/mL of NBT/BCIP ...
-
bioRxiv - Neuroscience 2024Quote: ... and stressed (n=4) DA neurons to prepare stranded RNAseq libraries following manufacturer’s recommendations using KAPA mRNA hyperprep (Roche Diagnostic). Each final library was quantified and qualified with 2200 Tapestation (Agilent) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... bmp2/4 and bmp5–8 was performed using traditional cloning methods and visualised with NBT/BCIP stock solution (Roche 11681451001), as previously described143.
-
bioRxiv - Molecular Biology 2024Quote: ... a total of 0.4–0.5 μg of plasmid and dsRNAs were transfected into BmN4 cells (4–6 × 104 cells per glass bottom 35 mm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche), and the cells were fixed 5–6 days later ...
-
bioRxiv - Biochemistry 2024Quote: ... 2.5 mL of lysis buffer (50 mM MES, pH 6.5 at 4 °C, plus one cOmplete™ EDTA-free protease inhibitor cocktail tablet (Roche) per 50 mL ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were incubated overnight at 4°C with a sheep anti-digoxigenin antibody conjugated with alkaline phosphatase (Roche Diagnostics) diluted 1:3500 in MABT ...
-
bioRxiv - Plant Biology 2024Quote: ... Halo-DREB2D proteins were immobilised on 20 µl of ChromoTek Halo-Trap Agarose Magnetic Beads for 1 h under agitation on a rotating wheel at 4 °C using 130 µl of cold DAP buffer (PBS supplemented with protease inhibitors (Roche), Nonidet P-40 (0.005% v/v) ...
-
bioRxiv - Developmental Biology 2024Quote: ... All steps were performed at 4⁰C with ice-cold buffers and in the presence of 1x complete EDTA-free protease inhibitor cocktail (Roche). Cells on beads were washed twice in wash buffer containing 0.05% digitonin (DigWash buffer ...
-
bioRxiv - Developmental Biology 2024Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell lysate was incubated for 30 min at 4 °C with 0.1 mg/mL DNAse I from bovine pancreas (Roche 11284932001) and 10 mM MgSO4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... using 1:50 of the reverse-transcribed RNA sample mixed with a specific primer pair (1uM final each, sequence in Table 4) and 2X KAPA SYBR FAST qPCR Master Mix (Roche) according to manufacturer’s conditions ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM β-mercaptoethanol) with 2 mM phenylmethylsulfonylfluorid (PMSF) or EDTA-free protease inhibitor cocktail tablet (Roche), 20 mg lysozyme (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 80 mM KCl, 0.2 mM spermine, 5 mM 2-ME, 0.5 mM spermidine, 0.2% IGEPAL CA-630, Roche mini EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Microbiology 2021Quote: ... 3 mM DTT and 1 mM PMSF) supplemented with protease inhibitor cocktail (Roche). Zirconium beads equivalent to 100 µL volume was added in microcentrifuge tubes and resuspended cells were lysed by 6 rounds of bead beating on a bullet blender ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Genetics 2024Quote: ... in 300-Wash Buffer (1 mL 1M HEPES pH 7.5, 3 mL 5M NaCl, 12.5 µL 2M spermidine, and 1 Roche c0mplete Protease Inhibitor EDTA-free tablet with ddH2O to 50 mL ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM ß-glycerophosphate, 5 mM NaF, 1 mM Na3VO4) and protease inhibitors (Roche cOmplete ULTRA Tablets, EDTA-free). The lysates were sonicated on ice (4x 10s bursts ...
-
bioRxiv - Microbiology 2024Quote: ... Cobas TaqMan RealTime HIV-1 (version 1 or 2; Hoffmann-La Roche, Basel, Switzerland) or the Abbott RealTime HIV-1 assay (Abbot Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a 2:1:1 ratio using X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...