Labshake search
Citations for Merck :
1 - 50 of 223 citations for pVectOZ GFP Transfection control since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... expressing vimentin with a GFP tag were produced by lentiviral transfection (LentiBrite GFP-Vimentin Lentiviral Biosensor, Merck Millipore) of HeLa cells ...
-
bioRxiv - Bioengineering 2023Quote: ... GFP-coding or GFP/Flagtagged nanobody constructs optimized for mammalian cell expression were transfected using the GeneJuice transfection reagent (Merck). 24 hours after transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... # HS0000050421 and control lentiviral particles (U6-gRNA/EF1a-puro-2A-Cas9-2A-GFP) were purchased from Merck/Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... and transiently transfected with the plasmid DNA containing GFP-tagged protein of interest (See Table S7 for plasmid constructs) using GeneJuice transfection reagent (70967, Merck) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Cell Biology 2020Quote: ... transfection was performed using GeneJuice transfection reagent (Merck), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Lentiviral plasmids encoding shRNAs targeting GFP (control; SHC005) and MAVS (06: TRCN0000149206; 45: TRCN0000148945) were obtained from the Sigma Mission library (Merck Darmstadt). Lentiviral particles for transduction were generated as follows ...
-
bioRxiv - Genomics 2023Quote: ... Transfection was done with NanoJuice Core Transfection Reagent (71900, Merck) following manufacturer’s instructions with an incubation of 48 h.
-
bioRxiv - Neuroscience 2023Quote: ... Transfections were performed using the GeneJuice® transfection reagent (Merck) according to the manufacturer’s specifications ...
-
bioRxiv - Neuroscience 2023Quote: ... Transfections were performed using the GeneJuice® transfection reagent (Merck) according to the manufacturer’s specifications ...
-
bioRxiv - Biophysics 2019Quote: ... Constructs of Kmpv1 and KmpvSP1 were transiently expressed as fusion proteins with GFP on the C-terminus using the liposomal transfection reagent GeneJuice® (MERCK KGaA, Darmstadt, Germany). Measurements were performed at room temperature in a bath solution containing ...
-
bioRxiv - Molecular Biology 2023Quote: ... or non-targeting siRNA control (MISSION siRNA universal negative control UNC2; Merck) using Lipofectamine RNAiMAX Reagent (ThermoFisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP (Merck, G6795) and TRIOBP-1 (Atlas Antibodies ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP (MERCK, MAB2510), RPA32 (Cell Signaling 2208) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfections: Cells were seeded 24 hours prior to transfection with XtremeGENE 360 (08724121001, Merck). Following the supplier’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfection agent X-tremeGENE (Merck) was added to optiMEM media (Gibco ...
-
bioRxiv - Molecular Biology 2024Quote: ... using EscortIV transfection reagent (Merck) growing in SF-4 Baculo Express ICM medium (BioConcept ...
-
bioRxiv - Cancer Biology 2020Quote: ... or scrambled control (Merck, HMC0002) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-GFP (Merck 000000011814460001), anti-LRP1 (Sigma L2295) ...
-
bioRxiv - Neuroscience 2020Quote: ... using GeneJuice Transfection Reagent (Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... MEFs were immortalized with SV40 large T-antigen by transfection using GeneJuice transfection reagent (Merck Millipore 70967).
-
bioRxiv - Cell Biology 2021Quote: ... Transfection of plasmids in MEF and HEK293T was carried out using GeneJuice Transfection Reagent (Merck Millipore, 70967) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... Transfections of DNA plasmids were carried out with the NanoJuice Transfection Kit (71900-3, Merck, Kenilworth, NJ, USA) or the Avalanche-Everyday Transfection Reagent (EZT-EVDY-1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfections for the generation of stable cell lines were performed using X-tremeGENETM 9 DNA transfection reagent (Merck), following the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transfected with gene-specific siRNAs or a control siRNA (MISSION siRNA Universal Negative Control #1, Merck) to a final concentration of 45 nM and 400 ng of the respective rescue plasmid with 12 µL of Liopfectamine 2000 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... mixed with Escort IV Transfection Reagent (Merck) were used to transfect 5×105 Sf9 cells in 1ml of SF900 II SFM growth medium (ThermoFisher scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... Mission siRNA Universal Negative Control #1 (Merck) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a rabbit IgG control (Merck Millipore) and used for IP as per manufacturer instructions (Invitrogen).
-
bioRxiv - Cancer Biology 2019Quote: ... or anti-rabbit IgG control (Merck; PP64). qPCR primers used to amplify SOX10 bound genomic sequences are shown in Supplemental Table 1.
-
bioRxiv - Cell Biology 2024Quote: ... or Mission siRNA Universal Negative Control (Merck) were used as controls ...
-
α-catenin links integrin adhesions to F-actin to regulate ECM mechanosensing and rigidity-dependencebioRxiv - Cell Biology 2021Quote: ... control cells were generated using the SHC202 -MISSION® TRC2 pLKO.5-puro Non-Mammalian shRNA Control Plasmid (Merck). After infection ...
-
bioRxiv - Plant Biology 2023Quote: ... Transfection with plasmids carrying the coding sequences of the indicated proteins was performed using Genejuice transfection reagent (Merck, Darmstadt, Germany). 48 hours after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... using the GeneJuice transfection agent protocol (Merck Millipore).
-
bioRxiv - Biochemistry 2021Quote: ... DNA transfection was performed with Genejuice (Merck Millipore) using the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Transient transfections were carried out using GeneJuice (Merck) in accordance with manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2024Quote: ... and 10 µg/ml Polybrene Transfection Reagent (Merck). After 24 h of incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... MISSION® siRNA Universal Negative Control #1 (Merck) was used as a negative control ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... positive control was Triton X-100 (Merck, T8787) at 0.1% ...
-
Heat Shock Factor 1 (HSF1) as a new tethering factor for ESR1 supporting its action in breast cancerbioRxiv - Cancer Biology 2021Quote: ... and eSpCas9-GFP protein (#ECAS9GFPPR, Merck KGaA) were introduced into MCF7 and T47D cells using Viromer® CRISPR (Lipocalyx GmbH ...
-
bioRxiv - Biophysics 2022Quote: ... Polyclonal rabbit-anti-GFP antibody (AB3080, Merck) was used to amplify the GFP signal ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-GFP (Merck, SAB5300167; 1:250), rabbit anti-tyrosine hydroxylase (Merck ...
-
bioRxiv - Biophysics 2019Quote: ... 30 µL of PEI transfection reagent (Sigma-Aldrich, Merck) and 10 µg of DNA plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... 24h post transfection 50 μg/ml Mycophenolic acid (Merck) and Xanthine (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... was transfected using X-tremeGENE HP Transfection Reagent (Merck) on HEK-293T overexpressing the human ACE2 and maintained in the previously described media containing 1 mg/mL of geneticin (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... was transfected using X-tremeGENE HP Transfection Reagent (Merck) on HEK-293T overexpressing the human ACE2 and maintained in the previously described media containing 1 mg/ml of geneticin (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... GeneJuice®Transfection Reagent (Merck Chemicals GmbH, Cat#70967), GeneRuler 1 kb DNA Ladder (Thermo Scientific ...
-
bioRxiv - Immunology 2023Quote: ... using the 293-free transfection reagent (Merck, Darmstadt, Germany) according to the manufactures’ protocols ...
-
bioRxiv - Cell Biology 2020Quote: ... and the protein loading control tubulin (Merck, Sigma-Aldrich). Immuno-reactive complexes were detected using HRP-conjugated secondary antibodies (Cell Signaling Technology ...