Labshake search
Citations for Merck :
101 - 150 of 244 citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... Samples were separated on a LiChrospher 60 RP-select Hibar RT 5 μm column (Merck) at 18 °C using a gradient of two solvents (0.25 % acetic acid (pH 4 ...
-
bioRxiv - Microbiology 2021Quote: ... structured microcosms were set-up in multi-well plates with a 0.22 µm filter membrane at the bottom of the well (Merck, Darmstadt, Germany) and containing 250 mg of sterile glass beads (with diameter of 80 to 120 µm ...
-
bioRxiv - Cell Biology 2022Quote: ... in 100µl of binding/wash buffer supplemented with protease inhibitor with protease inhibitor cocktail Set I-Calbiochem 1:100 (Cat# 539131, Merck Millipore) and phosphatase inhibitors ...
-
bioRxiv - Genomics 2023Quote: ... 20 µL of frozen cells were lysed by a 3-min incubation at 100°C in 5% boiling SDS with 2x final concentration of Protease Inhibitor Cocktail Set 1 (Merck Chemicals). After centrifugation (5 min 15000g) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then scrapped in cold PBS supplemented with protease inhibitors (Protease inhibitor cocktail set III, EDTA-free, Merck/Sigma-Aldrich) supplemented with glycine and isolated by centrifugation ...
-
bioRxiv - Bioengineering 2022Quote: ... The oligonucleotide primers used in this study (Table S2 in Supplementary material) were purchased from Merck. Chemocompetent E ...
-
bioRxiv - Cell Biology 2023Quote: ... Short DNA fragments up to 80 bp were inserted by aligning two compatible primers (Merck KGaA) that mimic specific restriction enzyme sites at both ends ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers for all target sequences were designed by using NCBI BLAST software and purchased from Merck as DNA oligos ...
-
bioRxiv - Neuroscience 2022Quote: ... The pellets were lysed for 1 h using cell protein extraction reagent (CW BioTech, CW0889, China) with protease inhibitor Cocktail set III (1 %, v/v, Merck, 535140, Germany), followed by centrifugation at 500×g for 10 min and the supernatants were collected ...
-
bioRxiv - Microbiology 2022Quote: ... serial decimal dilutions were get set from the suspension and 100µL of each diluent was spread on MRS agar (Merck GmbH, Darmstadt, Germany). The plates were incubated at 30°C for five days in an anaerobic atmosphere ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 30min at RT and then incubated with either anti-pHH3 (Merck, #06-570, 1:500) or anti-Ascl1 (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... solution for 30 min at RT and washed for 20min in a 10% formamide (Merck, #F9037), 2X SSC (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... The PCR product was gel purified (Illustra™ GFX PCR DNA and Gel Band Purification Kit, Merck) and used as template for in vitro transcription using the MEGAscript T7 Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... for 1 hour at RT and washed 3 times with TBS/Tw (TBS containing 0.05% v/v Tween-20 (8.17072.1000, Merck)) ...
-
bioRxiv - Immunology 2019Quote: ... PCR was performed using KOD polymerase (Merck). Samples were pooled across sub-amplicons and prepared for sequencing using NebNext Ultra II (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time quantitative PCR was performed using 5uL of KAPA Sybr Fast Universal 2x PCR master mix (Merck, #KK4601), 0.6uL of 5 uM forward primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were incubated for 1h30min at RT with primary antibodies Centrin-1(20H5) (1/1000, Merck 04-1424) and CP110 (1/250 ...
-
bioRxiv - Neuroscience 2023Quote: ... cryosections were incubated at RT for 1 h in darkness with the secondary antibody and Hoechst 33258 (Merck) as a nuclear counterstain ...
-
bioRxiv - Molecular Biology 2022Quote: ... and primers anchored in the homology arms of the HDRT specific for KI at the human TRAC locus (Merck). PCR amplicons (typically 2.5 mL ...
-
bioRxiv - Microbiology 2021Quote: ... PCR grade water (Lichrosolv®; Merck, Darmstadt, Germany). The qPCR was performed in triplicates using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Genomics 2022Quote: ... contained in the Kap2G Robust PCR kit (MERCK) per sample and 9 μl added to each well need to be used in a 96-well plate ...
-
bioRxiv - Cell Biology 2023Quote: ... or Power SYBR Green PCR Master Mix (Merck). For all groups ...
-
bioRxiv - Genomics 2023Quote: ... PCR reactions were conducted using KAPA Taq (Merck) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were incubated for 1.5 hours at RT with an antibody against Hp1α (Merck Millipore, MAB3584, 1:500 dilution) and RNA Polymerase II (Santa Cruz ...
-
bioRxiv - Neuroscience 2019Quote: ... Slides were air dried overnight in the dark at RT and cover-slipped using entellan-toluene solution (Merck Chemicals) the following day.
-
bioRxiv - Microbiology 2021Quote: Cells grown on glass coverslips were fixed in 4% PFA for 30 min at RT and permeabilized with 0.2% Triton X-100 (Sigma/Merck) in PBS for 10 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... the nuclei were visualized with Hoechst 33258 (Merck, B2883, 2 µg/ml in H2O at RT for 5 min).
-
bioRxiv - Neuroscience 2023Quote: ... 1c and Fig.3 were first fixed with 4% PFA solution for 30 minutes at RT and quenched with 0.1 M glycine (Merck) solution in PBS for 15 minutes at RT ...
-
bioRxiv - Bioengineering 2023Quote: ... for 20 min at room temperature (RT) and permeabilised overnight at 4 °C in 0.5% Triton X-100 (Merck) solution in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... specimens were post-fixed for 2 h at RT in 1% osmium tetroxide in 0.05 M cacodylate buffer pH 7.4 (Merck, Germany) and dehydrated stepwise in a graded ethanol series followed by 100% acetone ...
-
bioRxiv - Neuroscience 2024Quote: ... and then blocked for 1 h at RT with 0.2% Triton-X in PBS + 1% normal goat serum (NGS, Merck). Antibodies used and their concentration is found in Supplementary Table 4 ...
-
bioRxiv - Cell Biology 2024Quote: ... The immunostainings were performed at RT using tris-buffered saline (TBS) containing 1.6% (v/v) fish gelatine (G7765, Merck) as the basal buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were clarified by centrifugation (10,000 x g, 30 min, RT) and incubated for 1 hour with Ni-NTA His bind resin (Merck) rolling at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... The primers were mixed with 10ng of extracted DNA and KAPA SYBR® FAST master mix (Merck KGaA, Damstadt, Germany). The qPCR reaction was performed (BIORAD CFX96 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... All oligonucleotides used for mutagenesis were designed using the online Agilent Genomics ‘QuikChange Primer Design’ tool and purchased from Merck. All constructs were confirmed by in-house Sanger sequencing.
-
bioRxiv - Biochemistry 2022Quote: ... using primers listed in Table S1 and cloned into two tandem multiple cloning sites of pET-Duet vector (Novagen, Merck), using the restriction enzymes BamHI and SalI for MjFHα subunit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR amplification of gDNA from individual GCs (2 ng input) was performed with1 ul of JH reverse primer (10 uM, provided by MERCK) and 1.8 ul of LD forward primer set pools (10 uM per primer ...
-
bioRxiv - Cell Biology 2023Quote: ... namely the two double mutants R2248D/W2249S and S2270R/S2272W were created with the QuikChange protocol using primers supplied by Merck.
-
bioRxiv - Neuroscience 2020Quote: ... Cell lysis of all samples was performed after two washes with ice-cold PBS by incubating cells for 20 min in ice-cold 1% Triton X100 in PBS with protease inhibitor cocktails (Merck, Calbiochem set III, Cat. No. 539134), subsequent thorough scraping and sonication.
-
bioRxiv - Neuroscience 2020Quote: ... Bacteria were resuspended in (50mM HEPES, 250mM NaCl, 10% glycerol plus 1% Triton X-100, supplemented with protease inhibitors (Merck, Calbiochem set III, Cat. No. 539134) and subsequently sonicated ...
-
bioRxiv - Immunology 2021Quote: ... was mixed 1:1 and incubated at RT for 2-3 min or ECL substrate is added (Immobilon crescendo western HRP substrate, WBLUR0100, Merck). Membranes were then exposed to film and developed or visualised by chemiluminescence using the G:BOX Chemi gel doc Imaging System Instrument (Syngene) ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were permeabilized with 0.1 % Triton-X100 in PBS for 20 min at RT and samples were blocked with freshly prepared 3 % bovine serum albumin (BSA, Merck) in PBS for 1 h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... for 1 h at room temperature (RT) and revealed by chemiluminescence using Immobilon Crescendo or Forte Western HRP substrate (Millipore Merck).
-
bioRxiv - Cell Biology 2020Quote: ... MiRNA in situ hybridization was performed in formaldehyde and carbodiimide (EDC)-fixed TA cryo-sections (0,16M 90 min at RT, #25952-53-8, Merck KGaA). After washes with 0,2% glycine (#G8898 ...
-
bioRxiv - Cell Biology 2020Quote: ... alkylated with 40 mM Chloroacetamide (CAA) at RT for 30 min and protein amount was quantified using the Direct Detect Spectrometer from Merck. Protein digestion was performed using the Single-Pot Solid-Phase-enhanced Sample Preparation approach SP3 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were fixed with 4% (vol/vol) paraformaldehyde for 10 min at RT and permeabilized with 0.3% Tween 20 (#822184, Merck Millipore). All the primary and secondary antibodies were diluted in blocking buffer consisting of 0.3 M glycine ...
-
bioRxiv - Immunology 2020Quote: ... The sections were blocked in PBS containing 1% bovine serum albumin (BSA) for 1 h at RT and stained in blocking buffer containing primary antibody (anti-PP6C, Merck Millipore cat ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were washed and stained with indicated primary antibodies for 2 h at RT followed by incubation with PLA probes (Merck, Duolink® In Situ PLA® Probe Anti-Rabbit PLUS ...