Labshake search
Citations for Merck :
1 - 50 of 244 citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Primers for reverse-transcription PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR) were supplied by Merck with standard desalting at 100 µM in TE buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 1.8 ul of LD forward primer set pools (10 uM per primer, provided by MERCK) using 25 ul of Q5 Hot Start Master Mix (2X ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 1 ul of FR1 forward primer set pools (10 uM per primer, provided by MERCK) using 25 ul of Q5 Hot Start Master Mix (2X ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA oligonucleotides (RT-qPCR primers) were obtained from Merck (Rehovot, Israel).
-
bioRxiv - Developmental Biology 2023Quote: ... except for a different set of SYBR green primers (Sigma Merck, Supplementary Table 2). The obtained Ct values were analyzed using the ddCt method for relative quantification of mRNA expression derived from three independent experiments ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Gene insertion was verified by PCR using the primer pairs pETUpstream/DuetDOWN or DuetUP2/T7 Terminator (Merck) with Enc or mSOG-containing plasmids as template DNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... phosphatase inhibitor cocktail sets II (Merck) and IV (Merck) ...
-
bioRxiv - Immunology 2020Quote: ... All primers (Merck) were designed to span exon-exon boundaries and are available upon request ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers (Merck, Israel) for mRNA and lncRNA were designed using the NCBI Primer-Blast software ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with protease inhibitor cocktail set III (Cat No. 539134-1 set, 1:100, Merck Millipore, Rahway, NJ). The lysate was centrifuged at 16,000 g at 4 LJ for 10 minutes to remove insoluble samples ...
-
bioRxiv - Biochemistry 2021Quote: ... protease inhibitor cocktail set III (Merck Millipore), 1 mM PMSF) ...
-
bioRxiv - Biochemistry 2021Quote: ... protease inhibitor cocktail set III (Merck Millipore), 1mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Plant Biology 2020Quote: ... 1X Set III protease cocktail (Merck, 539134), 1 mM NaF ...
-
bioRxiv - Molecular Biology 2019Quote: ... Protease Inhibitor Cocktail Set III (Merck Millipore) and SUPERase• In RNase Inhibitor (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The sequence-specific primers used are shown in Table S3 (GAPDH and β2M primers were from Eurofins Scientific; other primers were from Merck). The expression levels were normalized to GAPDH and β2M endogenous gene levels ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the primers (Merck) listed in Supplementary table 5 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR amplification of the Round 1 PCR product (1 ul) with 1 ul of JH reverse primer (10 uM, provided by MERCK) and 1 ul of FR1 forward primer set pools (10 uM per primer ...
-
bioRxiv - Cell Biology 2023Quote: ... The allele-specific forward primers and common reverse primers were synthesized by Merck https://www.merckgroup.com/ ...
-
bioRxiv - Molecular Biology 2023Quote: ... The allele-specific forward primers and common reverse primers were synthesized by Merck https://www.merckgroup.com/ ...
-
bioRxiv - Developmental Biology 2022Quote: ... phosphatase inhibitor cocktail sets II and IV (Merck), and phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Synthetic Biology 2020Quote: ... Primers are ordered from Merck Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: ... mix with the primers (Merck) listed in Supplementary table 5 ...
-
bioRxiv - Biochemistry 2023Quote: ... Primers were obtained from Merck or Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with Protease Inhibitor Cocktail Set III (Merck Millipore), mixed by rotation at 4°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... complemented with protease inhibitor cocktail set III (Merck Millipore) and phosphatase inhibitor cocktail II (AG Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... or Phosphatase Inhibitor Cocktail Set III (Merck, 524627-1ML). The samples were lysed at 100°C for 4 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and Phosphatase Inhibitor Cocktail Set V (Merck Millipore, 524629). The samples were pipetted 10-20 times up and down until dissolved and were incubated on ice for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: FLAG-tagged or HA-tagged cDNA fragment of DDX43 was amplified by RT-PCR from total RNA of silkworm ovaries and cloned into pIEx-1 vector (Merck Millipore/Novagen) or pIExZ vector by In-fusion cloning kit (Takara).
-
bioRxiv - Systems Biology 2020Quote: ... supplied with 1% Protease Inhibitor Cocktail Set III (Merck Chemicals). After an incubation of 30 min at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... supplied with 1% protease inhibitor cocktail set III (Merck Chemicals) for 30 min at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... protease inhibitors (Protease Inhibitor Cocktail set III, EDTA free, Merck), phosphatase inhibitor cocktails (PhosSTOP ...
-
bioRxiv - Neuroscience 2023Quote: ... inside a 7 mL KIMBLE Dounce tissue grinder set (Merck), using 10 strokes with loose pestle followed by 10 strokes with tight pestle ...
-
bioRxiv - Developmental Biology 2023Quote: ... by using a KIMBLE Dounce tissue grinder set (Merck, #D8938), and immediately frozen in liquid N2.
-
bioRxiv - Neuroscience 2020Quote: ... 1 µl of Oligo-dT primer (Merck) and 5.7 µl of RT mix ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primers (Table EV1) were purchased from Merck Millipore ...
-
bioRxiv - Immunology 2023Quote: ... with the following Taqman Assays primers (Merck): Cyp1a1 (Mm00487218_m1) ...
-
bioRxiv - Cell Biology 2023Quote: Primers for qPCR were synthesised by Merck and used at 200 nM final (sequences in Supplemental Table 1) ...
-
bioRxiv - Cell Biology 2023Quote: ... All primers were purchased at 0.025µmol (Merck) and 1mM stock solutions prepared in TE (10 mM Tris ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with protease inhibitors (Merck, Calbiochem set III, Cat. No. 539134). Cell lysates were centrifuged at 20,000 g and supernatant was transferred to a tube containing Roti load I SDS sample buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5) with protease inhibitor Cocktail set III (Merck, 535140, Germany). The tissue debris was removed with low-speed centrifugation at 2000×g for 10 min and the supernatants were collected for further study.
-
bioRxiv - Microbiology 2022Quote: ... supplied with 1 % Protease Inhibitor Cocktail Set III (Merck Chemicals, Germany) for 30 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1x Phosphatase Inhibitor Cocktail Set V (Merck, cat. no 524629). First ...
-
bioRxiv - Microbiology 2019Quote: ... and pneumococcal killing was blocked by protease inhibitor cocktail set V (Merck, Darmstat ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 1x Protease Inhibitor Cocktail Set V (Merck Life Science, UK). Cell lysates were centrifuged for 15 minutes at 18,000 × g (4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... with the addition of 1x protease inhibitor set VII (Merck, Darmstadt, Germany). Cells were lysed by sonication and cell debris pelleted by centrifugation ...