Labshake search
Citations for Merck :
101 - 150 of 687 citations for hsa mir 301a 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Coverslips were washed ten times in PBS and ten times in ultrapure water before mounting on slides using Mowiol 4–88 (Merck) containing 200 nM 4′,6-diamidino-2-phenylindole (DAPI) ...
-
bioRxiv - Microbiology 2022Quote: ... Coverslips were washed ten times in PBS and ten times in ultrapure water before mounting on slides using Mowiol 4–88 (Merck) containing 200 nM 4′,6-diamidino-2- phenylindole (DAPI) ...
-
bioRxiv - Plant Biology 2021Quote: ... the hybridization with proper antibodies by SNAP i.d 2.0 Protein Detection System (Merck) was performed ...
-
bioRxiv - Biochemistry 2022Quote: ... For HRP detection (Fusion FX, Vilber Lourmat) chemiluminescent substrate Immobilon Classico (Merck Millipore) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... and probe hybridization and detection were performed using DIG Easy hyb (Merck #11603558001), anti-Dig AP (Merck #11093274910) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... at 1:5,000 through SNAP i.d.® 2.0 Protein Detection System (C73105, Merck). This apparatus has a vacuum-driven technology and a built-in flow distributor that actively drives reagents through the membrane.
-
bioRxiv - Immunology 2019Quote: ... This was followed by incubation with Chemiluminescent HRP detection reagent (Merck Millipore, #WBKLS0500) for 1 min before image acquisition.
-
bioRxiv - Microbiology 2023Quote: ... Signal was detected using Immobilon HRP chemiluminescence substrate detection reagent (Merck Millipore, Germany) and imaged in a chemiluminescent imager (BioRad ...
-
bioRxiv - Systems Biology 2023Quote: ... Signal detection was obtained using Luminata Crescendo Western HRP substrate (Merck Milipore®) and the ChemiDoc XRS+ Gel Imaging System (BioRad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sequentially incubated at RT for 5 min in 0.2 M NH4Cl (Merck) and 0.1% sodium borohydride (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... 10 times using Amicon centrifugal filter units (Merck Millipore) with a 100 kDa cut-off to a final volume of 5 mL ...
-
bioRxiv - Microbiology 2022Quote: ... 10 times using Amicon centrifugal filter units (Merck Millipore) with a 100 kDa cut-off to a final volume of 20 mL ...
-
bioRxiv - Microbiology 2023Quote: ... three times using 100 kDa amicon filters (Merck, Millipore) and centrifuging at 3’000 × g for 6 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µg of the digested RNA was reverse-transcribed as described above and validated by PCR using the KOD Xtreme HotStart Polymerase Kit (#71975-3; Merck, PCR program ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting pellet was retained and subject to extraction following the RED Extract Plant PCR-Kit (Merck KGaA, Darmstadt, Germany) protocol.
-
bioRxiv - Neuroscience 2020Quote: ... bioluminescent detection was performed using Immobilon Western HRP substrate (Merck Millipore WBKLS0500, 30 sec) and a Chemidoc Touch imager (Biorad ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... with an enhanced chemiluminescent substrate for detection of horseradish peroxidase (HRP; Merck, Darmstadt, Germany).
-
bioRxiv - Molecular Biology 2022Quote: ... Detection was carried out with the Immobilon Crescendo Western HRP substrate (Merck Millipore®), using the Chemidoc imaging system and the Image Lab software (Bio-Rad Laboratories).
-
bioRxiv - Biophysics 2023Quote: ... we blotted the proteins at RT on a PVDF membrane (Merck, Cat. No.: IPVH00010). We blocked the membranes for 1 h at RT with sterile filtered 5 % bovine serum albumin (BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were fixed for 10 minutes at RT with 4% formaldehyde (Merck, Sigma Aldrich) diluted in PBS 1X (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed using REDTaq® ReadyMix™ PCR Reaction Mix (R2523, Merck-SIGMA) using previously published primers (Charalambous et al ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product was run on an SDS gel and purified using the Agarose Gel DNA extraction kit from Merck (11696505001).
-
bioRxiv - Molecular Biology 2019Quote: ... Protein pellets were washed five times with cold Acetone (Merck) and submitted for subsequent mass spectrometric analyses by the Functional Genomics Center Zurich (FGCZ) ...
-
bioRxiv - Immunology 2021Quote: ... Chemiluminescence detection was performed by using the ECL™ Prime Western Blotting System (Cytiva, Merck) and acquired by ChemiDoc Imaging System (Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... Chemiluminescence detection was performed by using the ECL™ Prime Western Blotting System (Cytiva, Merck) and acquired by ChemiDoc Imaging System (Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... Detection was performed using an Immobilon® Forte Western membrane substrate (Merck KGA, Darmstadt, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Samples were separated on a LiChrospher 60 RP-select Hibar RT 5 μm column (Merck) at 18 °C using a gradient of two solvents (0.25 % acetic acid (pH 4 ...
-
bioRxiv - Microbiology 2021Quote: ... After each PCR step the amplified regions were separated on agarose gel and purified using Illustra GFX™ PCR DNA and Gel Band Purification Kit (Merck KGaA).
-
bioRxiv - Immunology 2021Quote: ... After each PCR step the amplified regions were separated on agarose gel and purified using Illustra GFX™ PCR DNA and Gel Band Purification Kit (Merck KGaA). The last oePCR step was performed to amplify the complete SARS-CoV-2S D19 sequence using primers carrying 15bp long 5’ overhangs homologous to the vector backbone ...
-
bioRxiv - Bioengineering 2019Quote: ... The NPs were washed three times in ethanol (99 % absolute, Merck) and three times in deionized water ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were washed three times with 1X PBS (Merck, D8537) to remove excess mucus ...
-
bioRxiv - Neuroscience 2022Quote: ... The animals used in our experiments were genotyped for expression of the transgene by quantitative PCR (qPCR) using the KAPA Mouse genotyping kit (Merck, Cat# MGKITKB-KK7301), with primer sequence (5’-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 30min at RT and then incubated with either anti-pHH3 (Merck, #06-570, 1:500) or anti-Ascl1 (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... solution for 30 min at RT and washed for 20min in a 10% formamide (Merck, #F9037), 2X SSC (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... PCR products were cleaned up using the illustra™ ExoProStar™ enzymatic PCR and sequence reaction clean kit according to the manufacturer’s instructions (Merck KGaA, Darmstadt, Germany). Cycle sequencing was performed using the BigDye™ Terminator v3.1 Cycle Sequencing kit and products were purified with the BigDye XTerminator™ purification kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and subsequently washed 4 times in Quencher solution (5 mM Trolox (Merck), 10 mM Na-Ascorbate (Merck)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then three times with 100 mM ammonium acetate (Merck, cat. # 1.01116.1000). Embryos were deposited in single spots on a microscope slide and desiccated for one hour in a vacuum chamber ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffers were filtered two times (0.22 μm pore size filter units, Merck) and degassed for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were washed two times in 50 % formamide (Emsure, ref 1.09684.1000, Merck), 5x saline sodium citrate (SSC ...
-
bioRxiv - Systems Biology 2020Quote: ... Nitrite concentrations in the effluent were always below detection limit (nitrite test strips MQuant, Merck, Darmstadt, Germany). Anoxic conditions were maintained via continuous sparging with Ar/CO2 (95%/5% v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... and revelation was performed using the ECL detection system according to the manufacturer’s instructions (Merck Millipore, WBKLS0500). Scanning for quantification of protein levels was monitored using ImageJ software ...
-
bioRxiv - Biochemistry 2024Quote: ... Final detection was carried out using chemiluminescence HRP substrates (Immobilon Western Chemiluminescent HRP Substrate; WPKLS0500; Merck Millipore) and imaged using ChemiDoc XRS+ (Bio-Rad).
-
bioRxiv - Immunology 2019Quote: ... PCR was performed using KOD polymerase (Merck). Samples were pooled across sub-amplicons and prepared for sequencing using NebNext Ultra II (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were incubated for 1h30min at RT with primary antibodies Centrin-1(20H5) (1/1000, Merck 04-1424) and CP110 (1/250 ...
-
bioRxiv - Neuroscience 2023Quote: ... cryosections were incubated at RT for 1 h in darkness with the secondary antibody and Hoechst 33258 (Merck) as a nuclear counterstain ...
-
bioRxiv - Microbiology 2022Quote: ... was diluted 100 times in 0.22 μm-filtered DMSO (IC Millex, Merck, USA) and Propidium Iodide (20 mM in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Cell Biology 2022Quote: ... washed three times with PBS and permeabilized with 0.1% Triton X-100 (Merck) in PBS for 5 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 times by centrifugal filtration (3K Amicon Ultra, Merck Millipore, 14’000g, 4°C) and buffer was exchanged to 4M Guanidine hydrochloride in 50mM HEPES (pH 7.8) ...