Labshake search
Citations for Merck :
401 - 450 of 5137 citations for WAS Protein Family Member 3 WASF3 Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Total protein concentration in eluates was measured using Direct Detect infrared spectroscopy (Merck, Darmstadt, Germany).
-
bioRxiv - Pathology 2022Quote: ... XO Activity was expressed as units/mg protein using native XO from buttermilk (Merck Millipore) as standard.
-
bioRxiv - Biophysics 2019Quote: ... the protein sample was filtered using a 30 kDa centricon filter (Merck Millipore, Darmstadt, Germany). The crude protein was then injected into a DEAE anion exchange column equilibrated with 10 mM Tris (pH 7.4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total protein of EECs was extracted with 1X RIPA buffer (20–188, Merck, Darmstadt, Germany), supplemented with Halt™ Proteinase & Phosphatase Single-Use inhibitor cocktail (78442 ...
-
bioRxiv - Immunology 2020Quote: ... the Protein G chip was regenerated for 30 seconds with 100 mM Glycin-HCl (Merck) pH 1.5 at 30 µL/min and the process was repeated starting a new cycle with the capture of the potentiating antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... Equal loading of protein samples on the membrane was confirmed using Ponceau S (MERCK, P3504) staining (2% Ponceau S (w/v ...
-
bioRxiv - Biophysics 2020Quote: ... Eluted protein was concentrated to ∼ 500uL using Amicon Ultra 5 centrifugal filters (Merck, Darmstadt, Germany). The affinity purified protein was further separated by gel filtration using a Phenomenex Yarra 3µm SEC-4000 300 x 7.8mm column (Phenomenex ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified protein was concentrated in centrifugal filter (Amicon Ultra-15, MWCO 50 kDa, Merck Millipore), aliquoted ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified protein was concentrated in centrifugal filter (Amicon Ultra-15, MWCO 50 kDa, Merck Millipore), aliquoted ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 µM Cdc5Plk1 re-phosphorylated Mif2 protein (M3) was immobilized on anti-FlagM2 beads (Merck) and incubated with 25 µM Ame1/Okp1 complex in binding buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluted protein solution was applied to a MonoQ 10/100 column (Sigma-Aldrich, Merck), equilibrated in MonoQ buffer A (40 mM Hepes ...
-
bioRxiv - Developmental Biology 2022Quote: ... the protein extract was loaded onto the centrifugal filter CO10 kDa (Merck Millipore, Darmstadt, Germany), and detergent were removed by washing five times with 8M Urea (Merck ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was then concentrated to 1 mg/ml using Amicon device 30K (Merck Millipore) and stored at -80°C.
-
bioRxiv - Microbiology 2020Quote: ... The purified protein was desalted and concentrated with the Centricon cutoff 10 kDa (Merck Millipore). The purity of the protein was analyzed by SDS-page and Western-blot using Anti-His antibodies.
-
bioRxiv - Biochemistry 2021Quote: ... The protein was then concentrated to 1 mg/ml using Amicon device 100K (Merck Millipore) and stored at -80°C ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was concentrated using a 30 kDa MWCO centrifugal filters (Amicon Ultra; Merck Millipore) and then gel filtered ...
-
bioRxiv - Cancer Biology 2022Quote: RIP was performed according to the Magna-RIPTM RNA-binding protein immunoprecipitation kit (Millipore/Merck) as previously described (Papoutsoglou et al ...
-
bioRxiv - Molecular Biology 2022Quote: The concentration of protein extracts was determined by BCA assay kit with BSA standards (Merck).
-
bioRxiv - Developmental Biology 2023Quote: ... the protein extract was loaded onto the centrifugal filter CO10 kDa (Merck Millipore, Darmstadt, Germany), and detergent were removed by washing five times with 8M Urea (Merck ...
-
bioRxiv - Biochemistry 2024Quote: ... Glycerol-free eluted protein was concentrated in an Amicon Ultra-0.5 Centrifugal Filter Unit (Merck) at 10,000 x g ...
-
bioRxiv - Biochemistry 2024Quote: ... the protein was filtered through an Ultrafree-MC centrifugal device with hydrophilic PTFE membrane (Merck) at 10,000 x g ...
-
bioRxiv - Molecular Biology 2024Quote: ... and protein complex was eluted in lysis buffer 2 containing 2.5 mM D-desthiobiotin (Merck). Protein tags were removed by overnight cleavage with HRV 3C protease ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein was transferred to an Immobilon®-FL PVDF membrane (Merck Millipore, Billerica, MA, USA) and blocked in Licor blocking buffer for 120 minutes (Licor ...
-
bioRxiv - Molecular Biology 2024Quote: ... In brief supernatant protein concentration was standardised prior to being concentrated using Microcon® (Merck) 10Kda filter columns and centrifugation (14,000g 20 minutes) ...
-
bioRxiv - Cell Biology 2024Quote: ... The chromatin (100 μg) was precleared with protein A agarose/Salmon sperm DNA beads (Merck) and 2 % taken as input ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total protein was extracted using RIPA buffer mixed with protease inhibitor cocktail (Millipore Merck, 539134) and quantified using Qubit® Protein Assay Kit (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membrane was incubated with secondary antibody for 1 hour at room temperature and proteins were detected using chemiluminescent HRP substrate (Merck-Millipore, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Molecular Biology 2023Quote: ... Relative levels of pFlareG were calculated for each condition using GAPDH as a housekeeping gene and normalized relative to FLAG-PTBP2 protein levels immunoprecipitated checked by western blot using α-FLAG M2 antibody (1:500; Merck-Sigma, F3165) and IRDye 800RD (1:10000 ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Bioengineering 2022Quote: ... Protein concentrations were determined with the BCA protein assay kit (Novagen, Merck KGaA), and protein homogeneity was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Microbiology 2019Quote: ... Solid phase synthesis took place on a CF peptide synthesizer (Intavis) using a Fmoc-PEG-Biotin NovaTag ™ resin (100 µmol; Merck), 2-Azidoacetic acid (Fluorochem ...
-
bioRxiv - Biophysics 2020Quote: ... Fractions containing monomeric I-Ek/MCC(ANP)-biotin complexes were concentrated with 10kDa Amicon®Ultra-4 centrifugal filters (UFC801024, MERCK), snap frozen in liquid nitrogen and stored in 1x PBS at −80 °C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Cancer Biology 2020Quote: ... CM (and the same volume of SM as control) was then concentrated by 3 kDa Amicon filters (Merck-Millipore) to a final volume of 100 μl/mouse and stored at −20°C until usage ...
-
bioRxiv - Biochemistry 2021Quote: ... 2/3 of the resulting supernatant (RIPA-insoluble fraction) was filtered through a nitrocellulose membrane (0.2 μM pore size, Merck) using a filter trap slot blot (Hoefer Scientific Instruments) ...
-
Actin binding domain of Rng2 sparsely bound on F-actin strongly inhibits actin movement on myosin IIbioRxiv - Biophysics 2022Quote: ... This was followed by concentration with a centrifugal concentrator (Amicon Ultra-15 3 k device, Merck Millipore, Burlington, MA), and after supplementing with 10 mM DTT ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... the supernatant was applied to a centrifugation filter (Amicon Ultra 0.5 mL 3 K device; Merck KGaA, Darmstadt, Germany), and the fraction containing free amino acids was obtained by centrifugation (15,000 × g ...
-
bioRxiv - Biophysics 2021Quote: ... the dry lipid film was rehydrated with 3 mL of 0.2 M 8.5 pH Bicine (Merck Life Science, Norway) buffer (pH adjusted with NaOH (Merck Life Science ...
-
bioRxiv - Molecular Biology 2022Quote: All samples were centrifuged at 16,000 × g for 30 min and 400 µL supernatant was loaded on a 0.5 mL centrifugal ultrafiltration unit with 3 kDa cut-off membrane (Amicon, Merck) and concentrated down to 20 µL ...
-
bioRxiv - Biochemistry 2022Quote: ... The LE11-27 DNA was dialyzed against the same buffer and concentrated to ~ 2.5 mM (Vivaspin 500, 3 kDa MWCO, Merck). The complex was formed by mixing the protein and the DNA in a 2:1 protein-to-DNA ratio (final concentration of 800 µM and 400 µM ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was transferred to an Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore, Catalogue no. UFC500396) and centrifuged at 10,000 g for 20 min at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... Cell supernatant was then concentrated by Tangential Flow Filtration with a Pellicon 3 Ultracel 10 kDa membrane (Merck Millipore) and loaded onto a 10 mL CaptureSelect™ C-tagXL affinity column that had been equilibrated in Tris-buffered saline (TBS ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Neuroscience 2022Quote: ... We tested several markers to label myelinated axons and settled on using an antibody against myelin basic protein (MBP; Merck, NE1019-100UL, 1:1000). We used two different antibodies for both PV (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... 10 μg of chromatin was immunoprecipitated with the one of the following antibodies: 5 μg CTCF antibody (07-729, Merck-Millipore), 5 μg RAD21 antibody (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... Staining was performed on fixed cells using an antibody directed against the hCoV-OC43 nucleoprotein as a primary antibody (Merck #MAB9013) followed by a horse radish peroxidase labeled detection antibody (Thermo Scientific #31430 ...