Labshake search
Citations for Merck :
101 - 150 of 480 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The PCR products were purified using PCRu96™Plates (Merck Millipore Inc., Burlington, MA) and sequenced by an ABI 3130 (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... The segments were amplified by PCR using KOD polymerase creating blunt-end products (Merck) using primers listed in Table S2 (Suppl ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All PCR reactions were carried out by KOD Hot Start DNA polymerase (Merck Millipore). PCR and Gel purification were done using Qiaquick nucleotide removal kit (qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... Other UL49.5 variants were generated by PCR using KOD Hot Start DNA polymerase (Merck), pLZRS-UL49.5-IRES-GFP(7 ...
-
bioRxiv - Microbiology 2023Quote: Magna RIP kit (Merck) was used to perform the RIP assay in accordance with the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Respective ELISA kits (insulin, leptin, IL-6 – MilliPlex Map Mouse Adipokine kit, Merck, Germany ...
-
bioRxiv - Cell Biology 2020Quote: ... The region was amplified by polymerase chain reaction (PCR) with KOD Hot Start Polymerase (Merck) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The purified PCR product was eluted in 10 µl water (Lichrosolv®; Merck, Darmstadt, Germany).
-
bioRxiv - Synthetic Biology 2021Quote: ... The designed promoters were obtained by either PCR (KOD Hot-Start DNA polymerase, Merck-Millipore). PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore) ...
-
bioRxiv - Microbiology 2022Quote: ... After testing for SARS-CoV-2 by PCR test (COBAS 6800, Merck México, Mexico city), they were classified as positive (AP ...
-
bioRxiv - Pathology 2021Quote: ... KAPA SYBR® FAST kit and qPCR kit were purchased from Merck (Darmstadt, Germany). RNeasy Mini kit and QIAcube were obtained from Qiagen (Venlo ...
-
bioRxiv - Genetics 2023Quote: ... a glycerol assay kit (Merck), and a d-gluconic acid/d-glucono-δ-lactone assay kit (Megazyme International) ...
-
bioRxiv - Biochemistry 2023Quote: ... while an ApopTag Kit (Merck) was used to detect apoptotic cells in accordance with the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Each PCR included a negative control using Milli-Q water (Merck; Rahway, New Jersey, United States) instead of template DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... the region surrounding the gRNA target sites were amplified by PCR with KOD Hot Start Polymerase (Merck) according to manufacturer’s instructions with the following primer pairs ...
-
bioRxiv - Microbiology 2020Quote: ... the SAG1 promoter and the GFP-coding fragment was amplified by PCR using the KOD polymerase (Merck) and the ML2477/ML2664 primers that included regions for integration by double homologous recombination ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Gene insertion was verified by PCR using the primer pairs pETUpstream/DuetDOWN or DuetUP2/T7 Terminator (Merck) with Enc or mSOG-containing plasmids as template DNA ...
-
bioRxiv - Cell Biology 2019Quote: MTT cell growth assay kit (Merck) was additionally employed to quantify cell viability upon LecB treatment ...
-
bioRxiv - Cell Biology 2021Quote: ... the alkaline phosphatase detection kit (Merck) was used following manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... cell counting kit 8 (Merck, 96992) was applied for 2.5 h as recommended by the manufacturer.
-
bioRxiv - Molecular Biology 2023Quote: ... 2958 bp) was purified using commercial DNA purification kits (GenElute™ HP Plasmid Miniprep kit, Merck, #NA0160), according to standard procedures ...
-
bioRxiv - Molecular Biology 2019Quote: ... an EcoRI restriction site was removed by performing a PCR on AT1.03 and AT1.03R122KR126K pDRF-GW using KOD polymerase (Merck-Millipore ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products of control and sort2 were concentrated by using Amicon Ultra-0.5 10K (UFC501096, Merck Millipore), and analyzed by pair-end sequencing using NovaSeq 6000 system (Illumina) ...
-
bioRxiv - Cell Biology 2020Quote: Cellular Senescence Assay kit (Merck Millipore: KAA002) was used to detect senescent AML12 by SA β-Gal staining as per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... with a customized Milliplex kit (Merck Millipore).
-
bioRxiv - Molecular Biology 2022Quote: ... and GenElute™ Plasmid Miniprep Kit (Merck), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... we used Sigma-Aldrich kit from Merck-Sigma ...
-
bioRxiv - Immunology 2023Quote: ... using Mouse Kapa Genotyping kit (Merck-Millipore), primers (500 nM ...
-
bioRxiv - Microbiology 2023Quote: ... Nutrient specific Spectroquant kit (Merck Millipore, US) was used and the concentration was determined spectrophotometrically using a 96-well plate with a microplate reader (FilterMax F5 ...
-
bioRxiv - Molecular Biology 2024Quote: Magna MeRIPTM m6A Kit (17-10499, Merck) was used to enable identification and transcriptome-wide profiling of m6A ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 μl MTT assay kit reagent (Merck) was then added to each well ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product was digested with restriction enzymes and then ligated into pET-17b (Merck Millipore, Burlington, MA, USA) to construct the expression vector pStSOR ...
-
bioRxiv - Microbiology 2022Quote: ... hawaiiensis NRRL 15010 were obtained by ligating PCR-amplified gene sequences with linearized pET11a or pET22b vectors (Merck-Novagen), respectively ...
-
bioRxiv - Immunology 2022Quote: ... The catalytically-inactive SPP D219A mutant was created using overlap-extension PCR (25) with KOD Hot Start Polymerase (Merck) and appropriate primers ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting PCR product was digested with XhoI and NcoI and introduced into the pET-28a vector (Merck Millipore). The ModA E165A ...
-
bioRxiv - Cell Biology 2019Quote: Multiplex analysis based on the xMAP Luminex technology was performed with the use of a kit for MILLIPLEX MAP Porcine Cytokine/Chemokine (magnetic) kit # PCYTMG-23K-13PX (Merck), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Chromatin was isolated from 20 million cells using the Magna ChIP A/G Kit (One-day chromatin Immunoprecipitation Kits, Merck) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... These samples were stored in the dark and analyzed colorimetrically using a commercial kit (Spectroquant Sulfide kit, Merck, Schaffhausen, Switzerland). Total particulate nitrogen and carbon were determined by filtration of 100 to 220 mL lake water on pre-combusted (400°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real time quantitative PCR was performed with KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich - Merck, UK, cat no KK4602) according to manufacturer’s instructions in a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... CDC50.3 and CDC50.4 were generated using a PCR fragment encoding the mAID–HA and the HXGPRT cassette produced using the KOD DNA polymerase (Novagen, Merck) with the vector pTUB1:YFP-mAID-3HA as template and the primers indicated in Table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... aeruginosa PAO1 served as a template for the amplification of the genes of interest via PCR using the KOD Xtreme polymerase (Novagen/Merck) and cloning primers containing the restriction sites (Eurofins Genomics) ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell debris was removed by centrifugation at 15k g for 1 min and 1 µl of the supernatant was used as template DNA for 25 µl PCR reaction (KOD HotStart, Merck) with primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was cloned using the hot fusion method (Fu et al., 2014) in pET30a+ vector (Merck, Molsheim France) pre-digested with EcoRI and BglII in order to fusion AgLTP24 with a N-terminal 6XHis flag ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR amplification of the Round 1 PCR product (1 ul) with 1 ul of JH reverse primer (10 uM, provided by MERCK) and 1 ul of FR1 forward primer set pools (10 uM per primer ...
-
bioRxiv - Cell Biology 2024Quote: ... Truncated forms were generated by PCR of the entire plasmid except the region to be excluded using KOD HotStart DNA polymerase (Merck) and the forward primers pUL71 295 fwd ...
-
bioRxiv - Molecular Biology 2020Quote: ... An enhanced chemiluminescence (ECL) detection kit (Merck Millipore) was used to develop the membranes ...
-
bioRxiv - Cell Biology 2022Quote: ... the Senescence Cells Histochemical Staining Kit (Merck, UK) was used according to the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2019Quote: The Muse Ki67 Proliferation kit (Merck, Princeton, USA) was used to detect proliferating and non-proliferating cells based on Ki67 expression ...