Labshake search
Citations for Merck :
1 - 50 of 480 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Primers for reverse-transcription PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR) were supplied by Merck with standard desalting at 100 µM in TE buffer ...
-
bioRxiv - Genomics 2022Quote: ... contained in the Kap2G Robust PCR kit (MERCK) per sample and 9 μl added to each well need to be used in a 96-well plate ...
-
bioRxiv - Immunology 2021Quote: ... The PCR product was gel purified (Illustra™ GFX PCR DNA and Gel Band Purification Kit, Merck) and used as template for in vitro transcription using the MEGAscript T7 Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: FLAG-tagged or HA-tagged cDNA fragment of DDX43 was amplified by RT-PCR from total RNA of silkworm ovaries and cloned into pIEx-1 vector (Merck Millipore/Novagen) or pIExZ vector by In-fusion cloning kit (Takara).
-
bioRxiv - Developmental Biology 2022Quote: The REDExtract-N-Amp™ Tissue PCR Kit (Merck, XNAT) was used for genotyping for all tissue explants ...
-
bioRxiv - Cancer Biology 2023Quote: Protein lysate was prepared in 1X CHAPS Lysis Buffer and the assay was performed using TRAPeze™ RT Telomerase Detection Kit (Merck) per manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... yolk sac or tail of embryos with the REDExtract-N-Amp Tissue PCR kit (Merck) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... DNA purification was performed using a SpinPrep™ PCR Clean-up Kit (Merck Millipore, Germany). DNA fragments were assayed by qRT-PCR using the primer sequences listed below ...
-
bioRxiv - Molecular Biology 2024Quote: The strains and samples were extracted using the RED Extract Plant PCR kit from Merck KGaA ...
-
bioRxiv - Genomics 2022Quote: ... followed by quenching with final 1 x Glycine solution for 5 min at RT utilizing the Magna Nuclear RIP (Cross-Linked) Nuclear RNA-Binding Protein Immunoprecipitation Kit (Merck millipore, 17-10520). Cross-linked cells were then centrifuged at 800 x g at 4°C and washed three times with ice cold DPBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of RNA was reverse transcribed using a First Strand cDNA Synthesis Kit (K1622; Fermentas, Burlington, ON, Canada) and polymerase chain reaction (PCR) using a SYBR Green qPCR kit (Merck, Darmstadt, Germany) with incubation at 37°C for 60 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were tested every 6-12 months either by PCR (LookOut kit, Sigma/Merck) or Mycostrips (Invivogen ...
-
bioRxiv - Cell Biology 2024Quote: ... The full-length MDM2 coding sequence was isolated from Addgene plasmid #16233 (pcDNA3 FRT MDM2) by PCR using the KOD hot start polymerase kit (Merck #71086), using primers that included a 5’ BamHI restriction site ...
-
bioRxiv - Biochemistry 2022Quote: ... Standard curves were generated using recombinant HIV-1 RT (Merck Millipore). The relative viral quantities were calculated based on the standard curve generated using QuantStudio-7 systems software (Applied Biosystems).
-
bioRxiv - Neuroscience 2023Quote: ... DNA oligonucleotides (RT-qPCR primers) were obtained from Merck (Rehovot, Israel).
-
bioRxiv - Physiology 2024Quote: ... cells were detached using Accutase (approx. 5 min at RT, Merck) and further passaged (one passage at d3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 minutes staining at RT with 2ng/μl of DAPI (Merck) in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... kept at room temperature (RT) for 3hours with silica gel (Merck, 101969) to completely dry and then stored at −80°C until use ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sequentially incubated at RT for 5 min in 0.2 M NH4Cl (Merck) and 0.1% sodium borohydride (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µg of the digested RNA was reverse-transcribed as described above and validated by PCR using the KOD Xtreme HotStart Polymerase Kit (#71975-3; Merck, PCR program ...
-
bioRxiv - Microbiology 2023Quote: ... Regular testing for mycoplasma contamination was performed to confirm contamination free culture using a PCR-detection kit (Sigma-Aldrich/Merck). The details of cell lines are provided in key resources table ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting pellet was retained and subject to extraction following the RED Extract Plant PCR-Kit (Merck KGaA, Darmstadt, Germany) protocol.
-
bioRxiv - Biophysics 2023Quote: ... we blotted the proteins at RT on a PVDF membrane (Merck, Cat. No.: IPVH00010). We blocked the membranes for 1 h at RT with sterile filtered 5 % bovine serum albumin (BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were fixed for 10 minutes at RT with 4% formaldehyde (Merck, Sigma Aldrich) diluted in PBS 1X (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed using REDTaq® ReadyMix™ PCR Reaction Mix (R2523, Merck-SIGMA) using previously published primers (Charalambous et al ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product was run on an SDS gel and purified using the Agarose Gel DNA extraction kit from Merck (11696505001).
-
bioRxiv - Plant Biology 2020Quote: ... Samples were separated on a LiChrospher 60 RP-select Hibar RT 5 μm column (Merck) at 18 °C using a gradient of two solvents (0.25 % acetic acid (pH 4 ...
-
bioRxiv - Microbiology 2021Quote: ... After each PCR step the amplified regions were separated on agarose gel and purified using Illustra GFX™ PCR DNA and Gel Band Purification Kit (Merck KGaA).
-
bioRxiv - Immunology 2021Quote: ... After each PCR step the amplified regions were separated on agarose gel and purified using Illustra GFX™ PCR DNA and Gel Band Purification Kit (Merck KGaA). The last oePCR step was performed to amplify the complete SARS-CoV-2S D19 sequence using primers carrying 15bp long 5’ overhangs homologous to the vector backbone ...
-
bioRxiv - Neuroscience 2022Quote: ... The animals used in our experiments were genotyped for expression of the transgene by quantitative PCR (qPCR) using the KAPA Mouse genotyping kit (Merck, Cat# MGKITKB-KK7301), with primer sequence (5’-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 30min at RT and then incubated with either anti-pHH3 (Merck, #06-570, 1:500) or anti-Ascl1 (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... solution for 30 min at RT and washed for 20min in a 10% formamide (Merck, #F9037), 2X SSC (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... PCR products were cleaned up using the illustra™ ExoProStar™ enzymatic PCR and sequence reaction clean kit according to the manufacturer’s instructions (Merck KGaA, Darmstadt, Germany). Cycle sequencing was performed using the BigDye™ Terminator v3.1 Cycle Sequencing kit and products were purified with the BigDye XTerminator™ purification kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... for 1 hour at RT and washed 3 times with TBS/Tw (TBS containing 0.05% v/v Tween-20 (8.17072.1000, Merck)) ...
-
bioRxiv - Immunology 2019Quote: ... PCR was performed using KOD polymerase (Merck). Samples were pooled across sub-amplicons and prepared for sequencing using NebNext Ultra II (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time quantitative PCR was performed using 5uL of KAPA Sybr Fast Universal 2x PCR master mix (Merck, #KK4601), 0.6uL of 5 uM forward primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were incubated for 1h30min at RT with primary antibodies Centrin-1(20H5) (1/1000, Merck 04-1424) and CP110 (1/250 ...
-
bioRxiv - Neuroscience 2023Quote: ... cryosections were incubated at RT for 1 h in darkness with the secondary antibody and Hoechst 33258 (Merck) as a nuclear counterstain ...
-
bioRxiv - Microbiology 2021Quote: ... PCR grade water (Lichrosolv®; Merck, Darmstadt, Germany). The qPCR was performed in triplicates using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... or Power SYBR Green PCR Master Mix (Merck). For all groups ...
-
bioRxiv - Genomics 2023Quote: ... PCR reactions were conducted using KAPA Taq (Merck) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were incubated for 1.5 hours at RT with an antibody against Hp1α (Merck Millipore, MAB3584, 1:500 dilution) and RNA Polymerase II (Santa Cruz ...
-
bioRxiv - Neuroscience 2019Quote: ... Slides were air dried overnight in the dark at RT and cover-slipped using entellan-toluene solution (Merck Chemicals) the following day.
-
bioRxiv - Microbiology 2021Quote: Cells grown on glass coverslips were fixed in 4% PFA for 30 min at RT and permeabilized with 0.2% Triton X-100 (Sigma/Merck) in PBS for 10 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... the nuclei were visualized with Hoechst 33258 (Merck, B2883, 2 µg/ml in H2O at RT for 5 min).
-
bioRxiv - Neuroscience 2023Quote: ... 1c and Fig.3 were first fixed with 4% PFA solution for 30 minutes at RT and quenched with 0.1 M glycine (Merck) solution in PBS for 15 minutes at RT ...
-
bioRxiv - Bioengineering 2023Quote: ... for 20 min at room temperature (RT) and permeabilised overnight at 4 °C in 0.5% Triton X-100 (Merck) solution in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... specimens were post-fixed for 2 h at RT in 1% osmium tetroxide in 0.05 M cacodylate buffer pH 7.4 (Merck, Germany) and dehydrated stepwise in a graded ethanol series followed by 100% acetone ...