Labshake search
Citations for Merck :
51 - 100 of 616 citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Biochemistry 2021Quote: ... applied to HPTLC plates (Kieselgel 60, Merck, Darmstadt, Germany), and developed with chloroform/methanol/water (55:45:9 ...
-
bioRxiv - Plant Biology 2021Quote: TLC was run on Silica 60 glass plates (Merck). Low-resolution mass-spectra were obtained on an Agilent 6340 Ion Trap instrument ...
-
bioRxiv - Bioengineering 2022Quote: ... Glass HPTLC Silica Gel 60 F254 plate (Merck, USA) was used for TLC ...
-
bioRxiv - Neuroscience 2021Quote: Lipids were spotted on HPTLC Silica Gel60 plates (Merck) using an automated TLC sampler (CAMAG ATS 4) ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were sealed with BreatheEasy seal (Sigma-Aldrich, Merck Life Science ...
-
bioRxiv - Immunology 2020Quote: ... Ninety-six-well PVDF membrane-bottomed plates (Merck Millipore) were coated with an anti-rat IFNγ capture antibody or IL4 capture antibody and incubated at 4 °C overnight ...
-
bioRxiv - Immunology 2022Quote: Multiscreen-IP 0.45 µM multiwell filter plates (#MAIPS4510, Merck) were coated with 50 µL/well of 2 µg/mL of mouse anti-bovine IFN-γ mAb (CC330 Bio-Rad Antibodies ...
-
bioRxiv - Immunology 2022Quote: 96-well plates (Millipore Multiscreen Filtration, Merck Millipore, Sweden) were pre-treated with coating buffer (0.1M Na-Carbonate–Bicarbonate buffer pH 9.5) ...
-
bioRxiv - Immunology 2022Quote: ... 96-well ELISpot plates (S5EJ044I10; Merck Millipore, Darmstadt, Germany) pre-wetted with 30 µl of 70% ethanol for 2 min before washing with 200 µl of sterile PBS ...
-
bioRxiv - Genetics 2023Quote: ... elegans were maintained on NGM plates (peptone, P4963, Merck; agar ...
-
bioRxiv - Cancer Biology 2023Quote: ... + 10% FBS (Fisher Scientific #10500064)] were plated on an ELISPOT plate (Merck Millipore #MAIP4510) coated overnight with 5 μg/mL anti-murine IFNγ capture antibody (BD #51-2525KZ) ...
-
bioRxiv - Biochemistry 2023Quote: ... Individual wells of PVDF membrane plates (MSIPS4510, Merck Millipore) were activated and equilibrated with 150 μl of 70% ethanol/water and urea sample buffer ...
-
bioRxiv - Microbiology 2024Quote: ... the plates were supplemented with 0.7 M NaCl (Merck) or 1 M sorbitol (Sigma).
-
bioRxiv - Microbiology 2024Quote: ... The cultures were thereafter streaked on MRS plates (Merck) and incubated for 48 h under anaerobic conditions hours at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time quantitative PCR was performed using 5uL of KAPA Sybr Fast Universal 2x PCR master mix (Merck, #KK4601), 0.6uL of 5 uM forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... PCR grade water (Lichrosolv®; Merck, Darmstadt, Germany). The qPCR was performed in triplicates using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Genomics 2022Quote: ... contained in the Kap2G Robust PCR kit (MERCK) per sample and 9 μl added to each well need to be used in a 96-well plate ...
-
bioRxiv - Cell Biology 2023Quote: ... or Power SYBR Green PCR Master Mix (Merck). For all groups ...
-
bioRxiv - Genomics 2023Quote: ... PCR reactions were conducted using KAPA Taq (Merck) according to manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we used a 10×20 cm silica gel plate (Merck, Darmstadt ...
-
bioRxiv - Developmental Biology 2021Quote: ... onto fibronectin-coated fibronectin-coated plates (1:100, Merck, UK), in 300 µL of N2B27media ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were seeded onto fibronectin-coated plates (1:100, Merck) in DPBS during 1h at 37°C and grown in N2B27 media - to promote the differentiation of mESCs into a stage resembling the post-implantation epiblast ...
-
bioRxiv - Biochemistry 2019Quote: ... TLC was performed on precoated silica plates (Merck, 60 F254) using UV light (254 or 366 nm ...
-
bioRxiv - Neuroscience 2020Quote: Cell culture inserts for 6-well plate (Merck Millipore, #044003)
-
bioRxiv - Neuroscience 2019Quote: ... Slices were placed on Millicell culture plate inserts (Merck Millipore) and maintained at 35°C ...
-
bioRxiv - Microbiology 2022Quote: ... or 24 well polystyrene plates (Corning®Costar® Merck) containing TAP or Tris minimal medium (The Chlamydomonas Sourcebook ...
-
bioRxiv - Systems Biology 2022Quote: ... aluminium plates coated with 0.25 mm 60F254 silica gel (Merck) were used and visualized with UV light at l = 254 nm or l = 365 nm.
-
bioRxiv - Neuroscience 2021Quote: ... NSCs were detached from the plate using accutase (Merck Millipore), centrifuged at 300 xg for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... TLC was carried out on Kieselgel 60 F254 plates (Merck).
-
bioRxiv - Bioengineering 2019Quote: ... using glass HPTLC Silica Gel 60 F254 plate (Merck, USA). The mobile phase was a mixture of hexane ...
-
bioRxiv - Microbiology 2020Quote: ... plates were developed using TMB substrate (Merck, cat. CL07-1000). Plates were read at 450 nm within 30 min using a Multiscan GO (Thermo Fischer Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... Plates were coated with 0.1% gelatin (Merck, #ES-006-B) and incubated at 37°C and 5% CO2 for 30 min before plating ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The plates were sealed with semipermeable Breathe-Easier membranes (Merck), and cells were grown in a plate shaker for three days (1,000 rpm ...
-
bioRxiv - Biochemistry 2022Quote: ... Using TLC plate aluminum foils (Silicagel 60, 20 × 20, Merck) which were cut to the desired size (minimum height of 10 cm) ...
-
bioRxiv - Biochemistry 2023Quote: ... TLC silica gel 60 F254 plates were procured from Merck, New Jersey ...
-
bioRxiv - Biochemistry 2023Quote: Pre-coated silica gel 60 F254 plates purchased from Merck were used for TLC ...
-
FlhE functions as a chaperone to prevent formation of periplasmic flagella in Gram-negative bacteriabioRxiv - Microbiology 2024Quote: CellASIC ONIX Microfluidic Platform and CellAsic Onix plates B04A (Merck) were used for live-cell observations ...
-
bioRxiv - Microbiology 2024Quote: ... all samples were transferred to a filter plate (Merck MultiScreen) and washed on a vacuum manifold ...
-
bioRxiv - Immunology 2023Quote: ... The disk was placed onto a blood agar plate (Merck), carrying a 5 ml nutrient soft agar overlay with 200 μL exponentially growing S ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PCR product was cloned into pFLAG-CMV5a (Merck) using restriction enzymes Bam HI and Kpn I ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were transferred to Filter plates (Durapore PVDF membrane, Merck Millipore), washed extensively and eluted with SDS sample buffer (Eberl et al. ...
-
Discovery and Optimization of Inhibitors for the Pup Proteasome System in Mycobacterium tuberculosisbioRxiv - Microbiology 2019Quote: Thin Layer Chromatography (TLC) was performed using TLC plates from Merck (SiO2 ...
-
bioRxiv - Microbiology 2022Quote: ... Petri plate covered with a durapore membrane filter (Merck, Kenilworth, NJ) for an easy harvest of mycelia ...
-
bioRxiv - Microbiology 2019Quote: ... TLC plates (3 × 10 cm) (TLC Silica Gel 60 F254, Merck) were spotted by simply touching the end of a capillary tube containing fungal crude extract to the coated side of the TLC plates ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 μg of transfer plasmid per plate using polyethylenimine (Merck) as transfection reagent ...
-
bioRxiv - Cell Biology 2021Quote: ... were seeded onto plates coated with 0.1% gelatin solution (Merck-Millipore). Lin28a+ cells and conventional MuSCs cells were cultured in Matrigel-coated plates All cells were incubated at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... TLC was done on glass-backed Silica Gel 60 plates (Merck) with chloroform/methanol/water (10/10/3 ...
-
bioRxiv - Cell Biology 2022Quote: ... pre-coated silica gel plates (Merck TLC silica gel 60 F254). Spots were detected by a UV lamp under 254 nm or 365 nm wavelength ...