Labshake search
Citations for Merck :
551 - 600 of 616 citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were plated at a density of 9000 cells/cm2 in PDL and laminin-coated 96 well Nunclon® plates (Merck, P8366), stained for βIII-Tubulin (Tuj1 ...
-
bioRxiv - Biochemistry 2021Quote: ... free radioligands bound to DCC were removed using a vacuum filtration system with a 96-well filtration plate (MultiScreenHTS HV, 0.45-mm pore size, Merck KGaA, Darmstadt, Germany) for the bound/free (B/F ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The residues were reconstituted in ethyl acetate and quantitatively applied to silica gel G thin-layer plates (Kieselgel G 60/DC-Fertigplatten, Merck, Art. 5721). The plates were developed to a distance of 16 cm in the organic phase of ethyl acetate:acetic acid:2,2,4-trimethylpentane:water (110:20:30:100 ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were monitored by thin layer chromatography (TLC) using TLC plates pre-coated with silica gel 60 F254 (Merck KGaA, Darmstadt, Germany), visualized with a handheld ultraviolet device either directly or after staining with 5% H2SO4 in ethanol ...
-
bioRxiv - Microbiology 2019Quote: ... Putative Salmonella colonies were selected by black appearance on XLD plates and confirmed by pink and white colony formation on Brilliant Green Agar (Merck, 70134-500G) supplemented with 0.35 g/L mandelic acid (Merck ...
-
bioRxiv - Molecular Biology 2021Quote: ... mESCs were grown on gelatin-coated plates under standard culture conditions (37°C, 5% CO2, humid) atop a ‘feeder’ layer of MitomycinC-inactivated (Merck Life Science) SNLP mouse fibroblasts and passaged upon ∼80% confluency every 2-3 days using TrypLE Express (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... each coverslip was carefully removed from the plates and attached (side opposite to biofilm) on the surface of a regular glass slide using Entellan mounting medium (Merck, Darmstadt, Germany) for subsequent scanning as below.
-
bioRxiv - Microbiology 2020Quote: Filter to remove host bacteria by transferring 200 µl (punch through pierceable tape) from each well to a 96-well filter Plate (0.45 µm) (e.g. MSHAS4510, Merck Millipore, Burlington MA US), pipette up and down a few times before extracting ...
-
bioRxiv - Physiology 2023Quote: ... the cell culture medium from 6-well plate was collected and either concentrated with Amicon Ultra microconcentrator 10 kDa cut-off (Merck Millipore #UFC501096) or not ...
-
bioRxiv - Physiology 2023Quote: ... the cell culture medium from 6-well plates was collected and either concentrated with Amicon Ultra microconcentrator 10 kDa cut-off (Merck Millipore #UFC501096) or not ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All yeast transformations were plated on synthetic complete (SC) plates containing 1.7 g/L yeast nitrogen base without amino acids and ammonium sulphate (Sigma Aldrich, Merck Life Science), 1 g/L monosodium glutamate (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293A cells transfected with G-CASE and pcDNA or N-terminally FLAG-tagged H1/2R constructs were grown for 48 hours in transparent 96-well plates (Brand, Wertheim, Germany) and washed once with 0.5% BSA (Merck KGaA, Darmstadt, Germany) in PBS ...
-
bioRxiv - Genomics 2023Quote: ... a ∼20%-confluent wild-type iPSC culture in a 12-well plate containing 1 ml/well of Essential 8 supplemented with 10 µM ROCK inhibitor (Merck, cat# Y0503) was co-transfected with the pZT-C13-L1 and pZT-C13-R1 plasmids (Cerbini et al ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture was grown for 2 hr at 37°C and stocks were made from the original plate by adding glycerol (Merck & Co., USA) to the final concentration of 15% and stored at -70°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: CC strips were dissected and then transferred to microtiter plate wells containing 5 μM bis-N-methylacridinium nitrate (Lucigenin; Merck, Darmstadt, Germany), some strips were stimulated with NADPH (100 μM ...
-
bioRxiv - Biochemistry 2023Quote: ... The 100-fold dilution of culture was made up to 10-4 dilutions and spotted on TYE plates (Hi-Media Laboratories Ltd., India) having 1% glucose (Merck & Co., USA) and ampicillin (Gold Biotechnology ...
-
bioRxiv - Plant Biology 2023Quote: ... An aliquot of each sample was subjected to TLC using a silica gel 60 F254 aluminum TLC plate (Merck Millipore, Burlington, USA), using a running buffer containing ethyl acetate/acetic acid/methanol/formic acid/water at a ratio of 80:40:10:10:10 (v/v) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All moisture-sensitive reactions were carried out in oven-dried glassware under N2 Thin-layer chromatograms (TLC) and flash chromatography separations were respectively performed on precoated silica gel 60 F254 plates (Merck, 0.25 mm) and on silica gel 60 (230-400 mesh) ...
-
bioRxiv - Microbiology 2023Quote: Quantification of polar lipids content on HPTLC was carried out as follows: Lipid extracts and polar lipids standards at varying concentrations were applied onto silica gel 60 F254 HPTLC plates (Merck KGaA, Germany) using an ATS 5 automatic TLC sampler (Camag ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 µL (= 5 mg fresh weight) of total lipids were applied onto a silica-coated chromatography plate (Silicagel 60 F254, 10x 20 cm; Merck, Rahway, NJ) and developed with hexane/ethyl ether/acetic acid (21 ...
-
bioRxiv - Immunology 2024Quote: Thin-layer chromatographic (TLC) analysis of lipids was performed on chromatographic plates (TLC Silica gel 60 F254; Merck KGaA 64071, Darmstadt, Germany) according to our previously published protocol20.
-
bioRxiv - Microbiology 2024Quote: ... standard dilution or sample was added into the wells of a 96-well clear bottom plate and 250 μL of Bradford reagent (Merck, Darmstadt, Germany) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real time quantitative PCR was performed with KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich - Merck, UK, cat no KK4602) according to manufacturer’s instructions in a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... CDC50.3 and CDC50.4 were generated using a PCR fragment encoding the mAID–HA and the HXGPRT cassette produced using the KOD DNA polymerase (Novagen, Merck) with the vector pTUB1:YFP-mAID-3HA as template and the primers indicated in Table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... aeruginosa PAO1 served as a template for the amplification of the genes of interest via PCR using the KOD Xtreme polymerase (Novagen/Merck) and cloning primers containing the restriction sites (Eurofins Genomics) ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell debris was removed by centrifugation at 15k g for 1 min and 1 µl of the supernatant was used as template DNA for 25 µl PCR reaction (KOD HotStart, Merck) with primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was cloned using the hot fusion method (Fu et al., 2014) in pET30a+ vector (Merck, Molsheim France) pre-digested with EcoRI and BglII in order to fusion AgLTP24 with a N-terminal 6XHis flag ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µg of the digested RNA was reverse-transcribed as described above and validated by PCR using the KOD Xtreme HotStart Polymerase Kit (#71975-3; Merck, PCR program ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR amplification of the Round 1 PCR product (1 ul) with 1 ul of JH reverse primer (10 uM, provided by MERCK) and 1 ul of FR1 forward primer set pools (10 uM per primer ...
-
bioRxiv - Microbiology 2023Quote: ... Regular testing for mycoplasma contamination was performed to confirm contamination free culture using a PCR-detection kit (Sigma-Aldrich/Merck). The details of cell lines are provided in key resources table ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting pellet was retained and subject to extraction following the RED Extract Plant PCR-Kit (Merck KGaA, Darmstadt, Germany) protocol.
-
bioRxiv - Cell Biology 2024Quote: ... Truncated forms were generated by PCR of the entire plasmid except the region to be excluded using KOD HotStart DNA polymerase (Merck) and the forward primers pUL71 295 fwd ...
-
bioRxiv - Microbiology 2020Quote: ... Glycolipid extracts of up to 15 μl were applied evenly onto half TLC silica plates (20 x 10 cm, Merck KGaA, Darmstadt, Germany). After drying ...
-
bioRxiv - Microbiology 2021Quote: ... aspergillus minimal media (AMM) [33] were added in pre-wetted 96-well MultiScreen Filter Plates HTS (1 μm glass fiber filter, Merck Millipore, Darmstadt, Germany) and incubated for 15 min at 37°C with either 25 μL PBS or 25 μL [Fe]TAFC solution (control – uptake block ...
-
bioRxiv - Cell Biology 2020Quote: ... EnSC were seeded at a clonal density of 30 cells/cm2 on 1 mg/ml fibronectin-coated 6-well plates and cultured in 10% DMEM/F12 medium supplemented with basic fibroblast growth factor (bFGF; 10 ng/ml; Merck Millipore, Watford, UK) for 10 days with a 50 % media change on day 7 ...
-
bioRxiv - Plant Biology 2022Quote: Lipid extracts from 500 mg mitochondria and 50 mg leaves were spotted onto TLC 60 plates (20 × 20 cm2, Merck KGaA, Darmstadt, Germany) in parallel with the following standards ...
-
bioRxiv - Synthetic Biology 2023Quote: ... agar plates were incubated in anaerobic jars filled with 100% nitrogen and suppled with Anaerocult™ A reagent packages (Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Neuroscience 2024Quote: The glass substrate was initially baked for 20 minutes at 200 ℃ on a hot plate to remove any water molecules on the surface and covered in AZ 5214E photoresist (Merck Performance Materials GmbH) via spin coating ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Molecular Biology 2019Quote: ... Amplified DNAs were purified with a Wizard SV Gel and PCR Clean-Up System and were used for in vitro transcription with Fluorescein RNA labeling Mix (Merck, #11685619910) and T7 (Merck ...
-
bioRxiv - Plant Biology 2019Quote: ... A 323 bp fragment was amplified from CAM leaf cDNA using high fidelity PCR with KOD Hot Start DNA Polymerase (Merck, Germany). The amplified fragment spanned the 3’ end of the PPC1 coding sequence and extended into the 3’ untranslated region to ensure specificity of the silencing to both of the aforementioned CAM-associated PPC1 gene copies ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Molecular Biology 2021Quote: ... 300-500bp homology fragments were amplified by PCR from iXist-ChrX genomic DNA using FastStart High Fidelity enzyme (Merck Life Science). N-terminal FKBP12F36V fragments were originally amplified originally from pLEX_305-N-dTAG (Addgene #91797 ...
-
bioRxiv - Biochemistry 2023Quote: ... This mix was then deposited in sterilized 5 mm diameter plastic rings cut from PCR tubes (#683201, Greiner bio-one, Merck KGaA) on the surface of a chicken embryo chorioallantoic membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product was run on an SDS gel and purified using the Agarose Gel DNA extraction kit from Merck (11696505001).
-
bioRxiv - Neuroscience 2024Quote: ... 5 μL of each sample were mixed with 7.5 μL of KAPA probe fast universal real-time PCR master mix (Merck, Darmstadt, Germany) and 2.5 μL of the indicated primer/probe combinations ...
-
bioRxiv - Microbiology 2022Quote: ... we used the same approaches as described above and spotted the 5 μl of bacteria on LB agar plates containing 2% of Skim Milk Powder for microbiology (Sigma-Aldrich/Merck KGaA, Darmstadt, Germany). Plates were incubated at 25°C and monitored for hemolytic and protease activities after 1 ...