Labshake search
Citations for Merck :
251 - 300 of 1048 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Slides were later stained with 5% Giemsa (Merck) for 4 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were suspended in 5% BSA (Merck; #12659) in PBS and single cells were sorted using a BD FACSJazz system into wells of a 96-well cell culture plate ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescein-labelled ssDNA substrate (5’[FAM]-pT50; Merck) was used in all SEC experiments to allow us to characterise complexes formed on DNA in the absence of any unwinding.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). At least 3 independent experiments with at least 2 independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). Four independent experiments were performed.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Biophysics 2019Quote: ... we incubated clean glass cover slips (glued to 8-well LabTek chambers) with 30 µg ml−1 fibronectin (Merck) in 1 x PBS for 2 h at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... IP samples were resolved on 8% or 10% SDS-PAGE gels and transferred onto Immobilon-P membranes (Merck Millipore) using a semidry transfer apparatus ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with sgRNA lentiviruses at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours and then reprogramming was initiated by addition of reprogramming medium ...
-
bioRxiv - Cell Biology 2021Quote: ... pellets were resuspended in urea lysis buffer (8 M Urea, 50 mM Tris pH 7.5, and 1:200 freshly added protease inhibitor cocktail (Merck)) ...
-
bioRxiv - Microbiology 2023Quote: ... and used to transduce TREx BCBL1-Rta cells in the presence of 8 μg/mL of polybrene (Merck Millipore). Virus supernatant was removed 6 hours post transduction and cells were maintained for 48 hours before puromycin (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein content of supernatant samples were normalized and analyzed using SDS-PAGE (mPAGE Bis-Tris 8%, Merck, Darmstadt, Germany) revealing specific protein bands in the supernatant while comparing wildtype and the T2SS mutant (xpsxcs ...
-
bioRxiv - Biochemistry 2024Quote: ... Dissolved IntC-UbcH5c-CAET-Ub was transferred to a dialyzer (D-Tube Dialyzer Maxi, MWCO 6– 8 kDa, Merck) in 300 mL of unfolding buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cell pellet was then lysed in 5X volumes of Lysis Buffer (300μL) [50mM Tris pH 8 (Merck, T6066), 150mM NaCl (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transduced with lentiviral particles in the presence of polybrene (8 g/mL, Cat# TR-1003-G, Merck); after 48 hours of transduction ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Biophysics 2021Quote: ... The His-tag cleaved Mpro in the flow-through was buffer-exchanged to 20mM Tris pH 8 using Amicon Ultra centrifugal filter (MWCO. 10kDa, Merck) and then loaded onto 5mL Q Sepharose column (HiTrap Q HP ...
-
bioRxiv - Molecular Biology 2021Quote: ... Smchd1 deletion was confirmed by immunofluorescence with an in-house made anti-Smchd1 antibody during the immunofluorescence experiments (Mab #8, now available commercially from Merck).
-
bioRxiv - Pathology 2020Quote: ... was performed placing the sections in a 800 ml glass container filled with the retrieval solutions (10 mM EDTA in Tris-buffer pH 8, Merck), irradiate in a household microwave oven at full speed for 8 min ...
-
bioRxiv - Biochemistry 2020Quote: Protein pellets were dissolved in 50 μl of 8 M Urea and loaded onto a 30 K centrifugal filter unit (Merck). Preparation for MS was done as described in [64] ...
-
bioRxiv - Neuroscience 2021Quote: ... Dissected tissue was placed in ice cold lysis buffer (150 mM NaCl, 1% NP-40, 50 mM Tris-HCl pH 8, and cOmplete Mini Protease Inhibitor, Merck) and homogenized with a syringe and 20G needle ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 ug inactive MEK1 (C-terminally His-tagged) in a total volume of 40 μL buffer (20 mM Hepes pH 8 (MERCK, Sigma Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... the samples were transferred into 50 mL conical tubes with 20 mL of SM buffer (50 mM Tris HCl, 100 mM NaCl, 8 mM MgSO4, pH 7.5, Merck, Germany) and vortexed for 60 s to remove phage Φ6 particles attached to sample surfaces ...
-
bioRxiv - Cell Biology 2020Quote: ... MiRNA in situ hybridization was performed in formaldehyde and carbodiimide (EDC)-fixed TA cryo-sections (0,16M 90 min at RT, #25952-53-8, Merck KGaA). After washes with 0,2% glycine (#G8898 ...
-
bioRxiv - Microbiology 2022Quote: ... 1.5×104 conidia of each strain were inoculated in 300 µL of RPMI in the presence of 8 µg/mL voriconazole (European Pharmacopoeia, -EP- Reference Standard, Merck) and incubated for 48 hours at 37 °C with occasional shaking ...
-
bioRxiv - Plant Biology 2019Quote: ... Cells were then lysed in lysis buffer (50 mM KHPO4 pH 8, 100 mM NaCl, 10 mM Imidazole, 1X BugBuster (Merck), 25 U/ml Benzonase nuclease ...
-
bioRxiv - Genomics 2021Quote: ... serial 10-fold dilutions were prepared from the viral stock and used to transduce mESCs in a 6-well plate (Mock plus 10-2 to 10-6) together with 8 ng/µl polybrene (Merck) in duplicates ...
-
bioRxiv - Genetics 2021Quote: ... 5 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−2 to 10−6) for transduction with 8 ng/µl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gaithersburg, MD, USA) and 8-μm-pore polycarbonate membranes (Nucleopore, Pleasanton, CA, USA) coated with 10 μg/ml fibronectin (Merck) as described elsewhere (Prevete et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were replated onto coverglass (8×104 per well) coated with 50 µg/ml Poly-D-Lysine (PDL, Merck, USA) for imaging experiments.
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Molecular Biology 2022Quote: ... LV tissue was solubilized in 50 mM Tris-SDS buffer (pH 6.8) containing 8 µg/mL leupeptin (Merck Life Science) and phosphatase inhibitor cocktail (Merck Life Science) ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sonicated in 1 M KOH solution (6592-3705, Daejung) for 30 min and then washed with Milli-Q water (Direct 8, Merck) to remove remaining KOH solution ...
-
bioRxiv - Biophysics 2023Quote: ... Homogenization of proteins and single molecules were performed using 8 U/ml proteinase K (PK, #P4850 Sigma Aldrich now Merck) in digestion buffer (800 mM guanidine HCl ...
-
bioRxiv - Microbiology 2023Quote: ... supernatant containing lentivirus was filter sterilised and combined with TREx BCBL1-Rta cells in 8 μg/ml polybrene (Merck Millipore). After 8 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clones were trial-screened for positive PCR products by making mirror plates and subjecting one of the plates to cell lysis (50mM Tris-HCl pH 8, 1mM EDTA, 0.5% Tween-20, 50-80 μg/ml Proteinase K Merck-3115801001) at 37°C overnight ...
-
bioRxiv - Immunology 2023Quote: ... WT mice were 7-8 week-old Mice (C57BL/6 WT or Nr4a3-Timer-GS) were injected with 10 mg/kg azoxymethane (Merck) via i.p ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on manufacturer-suggested minimum seeding density) with lenti/retroviral supernatant in a 1:1 volumetric ratio and 8 µg/mL hexadimethrine bromide (Merck), before centrifugation at 900g for 30 min and returning to incubation at 37°C with 5% CO2 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... Target cells were transduced with 0.5 mL of viral supernatant in 3 mL of total medium supplemented with 8 µg/mL polybrene (Merck Sigma). 2 to 4 days post transduction ...
-
bioRxiv - Cell Biology 2023Quote: For the thin layer chromatography (TCL) an aliquot of lipid extract corresponding to 8 mg of DCW was applied to silica gel TLC plates (Merck) by a Linomat 5 semiautomatic sample applicator (Camag) ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were gently transferred to a 15-mL conical tube (Falcon) containing 8 mL of 4°C RPMI 1640 (ATCC modification) medium supplemented with 10 U/mL DNaseI (Merck). The cryovial was rinsed with 1 mL of the RPMI medium to transfer the remaining NK cells to the 15-mL tube ...