Labshake search
Citations for Merck :
201 - 250 of 1048 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml insulin (Merck, cat. # I6634), 5 µg/ml holo-transferrin (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ng/ml EGF (Merck, cat. #SRP3196), 50 nM dexamethasone (Merck ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin, Bovine Serum, 12659, Merck Millipore) powder solved in 1 × TBST ...
-
bioRxiv - Microbiology 2019Quote: ... The pellet was dissolved in three ul distilled water and spotted onto 5×5 cm silica gel plates (Merck) using automatic TLC sampler ...
-
bioRxiv - Developmental Biology 2021Quote: ... The HPLC was equipped with a hydrophilic ZIC-pHILIC column (150 × 2.1 mm, 5 μm) with a ZIC-pHILIC guard column (20 × 2.1 mm, 5 μm, Merck Sequant). 5ul of each sample was used for each assay ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 ml conditioned medium was centrifuged (5 min, 500g) and filtered through Amicon Ultra-0.5 Centrifugal Filter unit (Merck). Ammonia in TIFs and SCFs was then quantified using Dimension Ammonia assay (Siemens ...
-
bioRxiv - Microbiology 2019Quote: ... Each sample was separated on 8% polyacrylamide gels and transferred onto 0.45 µm PVDF membranes (Merck, Darmstadt, Germany). PVDF membranes were blocked with PBS containing 0.05% Tween 20 (PBST ...
-
bioRxiv - Physiology 2019Quote: Chemotaxis of hMSCs was assessed using Boyden chambers with a pore size of 8 μm (Merck Millipore, PIEP12R48). Cells were seeded on the upper membrane in serum free α-MEM medium at a density of 30,000 cells/cm2 and allowed to adhere 4 h before being transferred to the wells containing chemotactant (Medium (serum free) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Equal amounts of protein were separated by 8-12% SDS-PAGE and transferred to PVDF membranes (Millipore-Merck). Membranes were incubated with primary antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: ... 8 M urea and transferred onto a 30 kDa molecular weight cut-off column (Microcon-30, Merck Millipore). 150 μL 100 mM TRIS/HCl pH 8.5 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The viral supernatant was mixed with 8 μg/ml DEAE-dextran and 1000 units/ml ESGRO (Merck Millipore) and added directly to the E14tg2a cells ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The protein samples were separated by 8% and 12% SDS PAGE and were transferred to PVDF membranes (Merck Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... thawed pellet was resuspended into 20 ml lysis buffer (0.025 M Tris pH 8; 0.5 M NaCl; 2 mM MgCl2; 100 U/ml Benzonase (Merck); 0.25 mg/ml lysozyme (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... before transduction of TREx BCBL1-Rta cells in the presence of 8 μg/mL of polybrene (Merck Millipore). Virus supernatant was removed 6 hours post transduction and fresh media added ...
-
bioRxiv - Neuroscience 2022Quote: ... as internal standard (IS) in 67% deionized water and 33% acetonitrile (ACN, 900667, CAS 75-05-8, Merck). The LTQ Orbitrap ELITE ETD (Thermo Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... ECD peak fractions were collected from pH 8 experiments and buffer exchanged using centrifugal concentration units (Amicon, Merck) into pH 6 purification buffer (50 mM MES ...
-
Preference of CAMSAP3 for expanded microtubule lattice contributes to stabilization of the minus endbioRxiv - Biophysics 2023Quote: ... pH 7.3) supplemented with 8% glycerol and 0.5 mM DTT using a 30-kDa-cutoff centrifugal filter (UFC503096; Merck). Finally ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transduced with 1 MOI of concentrated virus containing 8 ug/mL Polybrene (Merck, TR-1003-G). Two days later ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 8) and concentrated to 30 mg/ml using an Amicon Ultra-15 Centricon (Millipore Merck, Darmstadt, Germany). Crystallization experiments were performed with ORYX8 pipetting robot (Douglas Instruments ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nuclear translocation of FLAG-ER-SAMD1 was induced by adding 200 nM 4-OHT (Merck; 68392-35-8) for 24 h.
-
bioRxiv - Plant Biology 2024Quote: ... 5.5 µL of enzyme solution (275 ng of Trypsin Gold, Promega V5280; and 8 units of Benzonase, Merck Millipore 70746 ...
-
The satiety hormone cholecystokinin gates reproduction in fish by controlling gonadotropin secretionbioRxiv - Neuroscience 2024Quote: ... They were then incubated with rabbit anti-cholecystokinin (26–33) (CCK-8) antibody (diluted 1:1000, Merck, C2581) for 16 h at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 2 × 104 cells were cultured in an 8-well chamber slide (Merck Millipore, Massachusetts, USA) and then fixed with 4% paraformaldehyde in PBS buffer for 15 min at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Microbiology 2019Quote: ... For experiments using 5-FAM-rifampicin (Merck-Millipore), MLP or persistence phase cells were exposed to 1.5 µg/ml (concentration equimolar to 10x MBC rifampicin ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...
-
bioRxiv - Microbiology 2019Quote: ... Mounted cells were fixed in 5% glutaraldehyde (Merck) in 0.1 M cacodylate (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% BSA (Merck KGaA) in TBS (Merck KGaA ...