Labshake search
Citations for Merck :
401 - 450 of 1195 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Immunology 2022Quote: ... the cells were transferred to a single well containing a monolayer of mitomycin C (Cat no. 50-07-7, Millipore Sigma, Merck, Darmstadt, Germany)-treated OP9/ OP9-DL1 cells or were kept unaltered ...
-
bioRxiv - Biochemistry 2021Quote: ... a biotinylated DNA oligonucleotide complementary to the target tRNA (Supplementary Table 7) was immobilized on Novagen Streptavidin Agarose resin (Merck-Millipore, Burlington, MA) in a 0.22 μm Ultrafree-MC filter cup (Merck-Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50 mM EDTA) with 1 µl lyticase (17 U/ µl in 10 mM KPO4 pH 7, 50% glycerol, Merck >2000 U/mg L2524), heated to 50°C for 2 min before addition of 40 µl molten CleanCut agarose (Bio-Rad 1703594) ...
-
bioRxiv - Biochemistry 2024Quote: Mixing of lysozyme crystals (7×2 mm; grown by batch crystallisation) with 25 mM sulfanilic acid azochromotrop (SAA, Merck, lmax 505–510 nm), a highly absorbing red dye ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 μM of para-amino-Blebbistatin (Optopharma, DR-Am-89) was applied for one hour to inhibit NMII activity and 100 μM CK-666 (Merck, SML0006) for four hours to inhibit the Arp2/3 complex ...
-
bioRxiv - Cell Biology 2021Quote: ... rinsed four times with MTSB and treated for one hour at RT with 10% dimethylsulfoxide + 3% Igepal CA-630 (Merck # I3021) dissolved in MTSB ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated overnight at 4°C in blocking solution containing one of the following primary antibodies: anti-GFAP (1:2000; Merck Millipore) and anti-Iba1 (1:500 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Eluted protein samples were combined in one tube and desalinated using an ultrafiltration tube (Amicon Ultra 3 kDa molecular weight cut-off, Merck/Millipore) with Buffer C (50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Immunology 2021Quote: ... 20 μl of this cell/collagen mixture was added in one well of pre-cooled Corning™ 96-Well half-area plate (Merck) and the plate was centrifuged ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Eluted protein samples were combined in one tube and desalinated using an ultrafiltration tube (Amicon Ultra 3 kDa molecular weight cut-off, Merck/Millipore) with Buffer C (25 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Biochemistry 2023Quote: ... 150,000 to 200,000 HEK293-EBNA cells were plated in 1 mL complete DMEM per well of 12-well cell culture plates (#665180, Greiner bio-one, Merck KGaA). After 24 h ...
-
bioRxiv - Microbiology 2023Quote: ... Cultures were grown in 25% TSB medium at 28°C in static conditions in glass microcosms with one layer of ColiRoller glass beads (Millipore, Merck, USA) covering the base of the microcosm to provide additional spatial structure ...
-
bioRxiv - Bioengineering 2022Quote: ... at a 0.2 μM synthesis scale with desalting purification (HPLC purification in case of labelled ones) were purchased from Merck (Sigma-Aldrich). Mowiol® 4-88 ...
-
bioRxiv - Microbiology 2024Quote: ... All but one sample for microbiological analyses was collected onto 0.22 μm pore size filters (type GVWP; Merck Millipore, Darmstadt, Germany) held in pressure-resistant stainless steel filter holders directly connected to the tubing outlet under in-situ hydraulic pressure conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... was followed by 5 minutes of rinsing with water and 20-30 seconds of Eosin solution (Merck, 115935, 100ml supplemented with one drop of acetic acid, Merck, 1.00063). For PAS staining ...
-
bioRxiv - Biophysics 2021Quote: ... The His-tag cleaved Mpro in the flow-through was buffer-exchanged to 20mM Tris pH 8 using Amicon Ultra centrifugal filter (MWCO. 10kDa, Merck) and then loaded onto 5mL Q Sepharose column (HiTrap Q HP ...
-
bioRxiv - Molecular Biology 2021Quote: ... Smchd1 deletion was confirmed by immunofluorescence with an in-house made anti-Smchd1 antibody during the immunofluorescence experiments (Mab #8, now available commercially from Merck).
-
bioRxiv - Pathology 2020Quote: ... was performed placing the sections in a 800 ml glass container filled with the retrieval solutions (10 mM EDTA in Tris-buffer pH 8, Merck), irradiate in a household microwave oven at full speed for 8 min ...
-
bioRxiv - Biochemistry 2020Quote: Protein pellets were dissolved in 50 μl of 8 M Urea and loaded onto a 30 K centrifugal filter unit (Merck). Preparation for MS was done as described in [64] ...
-
bioRxiv - Neuroscience 2021Quote: ... Dissected tissue was placed in ice cold lysis buffer (150 mM NaCl, 1% NP-40, 50 mM Tris-HCl pH 8, and cOmplete Mini Protease Inhibitor, Merck) and homogenized with a syringe and 20G needle ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 ug inactive MEK1 (C-terminally His-tagged) in a total volume of 40 μL buffer (20 mM Hepes pH 8 (MERCK, Sigma Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... the samples were transferred into 50 mL conical tubes with 20 mL of SM buffer (50 mM Tris HCl, 100 mM NaCl, 8 mM MgSO4, pH 7.5, Merck, Germany) and vortexed for 60 s to remove phage Φ6 particles attached to sample surfaces ...
-
bioRxiv - Cell Biology 2020Quote: ... MiRNA in situ hybridization was performed in formaldehyde and carbodiimide (EDC)-fixed TA cryo-sections (0,16M 90 min at RT, #25952-53-8, Merck KGaA). After washes with 0,2% glycine (#G8898 ...
-
bioRxiv - Microbiology 2022Quote: ... 1.5×104 conidia of each strain were inoculated in 300 µL of RPMI in the presence of 8 µg/mL voriconazole (European Pharmacopoeia, -EP- Reference Standard, Merck) and incubated for 48 hours at 37 °C with occasional shaking ...
-
bioRxiv - Plant Biology 2019Quote: ... Cells were then lysed in lysis buffer (50 mM KHPO4 pH 8, 100 mM NaCl, 10 mM Imidazole, 1X BugBuster (Merck), 25 U/ml Benzonase nuclease ...
-
bioRxiv - Genomics 2021Quote: ... serial 10-fold dilutions were prepared from the viral stock and used to transduce mESCs in a 6-well plate (Mock plus 10-2 to 10-6) together with 8 ng/µl polybrene (Merck) in duplicates ...
-
bioRxiv - Genetics 2021Quote: ... 5 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−2 to 10−6) for transduction with 8 ng/µl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gaithersburg, MD, USA) and 8-μm-pore polycarbonate membranes (Nucleopore, Pleasanton, CA, USA) coated with 10 μg/ml fibronectin (Merck) as described elsewhere (Prevete et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were replated onto coverglass (8×104 per well) coated with 50 µg/ml Poly-D-Lysine (PDL, Merck, USA) for imaging experiments.
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Molecular Biology 2022Quote: ... LV tissue was solubilized in 50 mM Tris-SDS buffer (pH 6.8) containing 8 µg/mL leupeptin (Merck Life Science) and phosphatase inhibitor cocktail (Merck Life Science) ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sonicated in 1 M KOH solution (6592-3705, Daejung) for 30 min and then washed with Milli-Q water (Direct 8, Merck) to remove remaining KOH solution ...
-
bioRxiv - Biophysics 2023Quote: ... Homogenization of proteins and single molecules were performed using 8 U/ml proteinase K (PK, #P4850 Sigma Aldrich now Merck) in digestion buffer (800 mM guanidine HCl ...
-
bioRxiv - Microbiology 2023Quote: ... supernatant containing lentivirus was filter sterilised and combined with TREx BCBL1-Rta cells in 8 μg/ml polybrene (Merck Millipore). After 8 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clones were trial-screened for positive PCR products by making mirror plates and subjecting one of the plates to cell lysis (50mM Tris-HCl pH 8, 1mM EDTA, 0.5% Tween-20, 50-80 μg/ml Proteinase K Merck-3115801001) at 37°C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on manufacturer-suggested minimum seeding density) with lenti/retroviral supernatant in a 1:1 volumetric ratio and 8 µg/mL hexadimethrine bromide (Merck), before centrifugation at 900g for 30 min and returning to incubation at 37°C with 5% CO2 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... Target cells were transduced with 0.5 mL of viral supernatant in 3 mL of total medium supplemented with 8 µg/mL polybrene (Merck Sigma). 2 to 4 days post transduction ...
-
bioRxiv - Cell Biology 2023Quote: For the thin layer chromatography (TCL) an aliquot of lipid extract corresponding to 8 mg of DCW was applied to silica gel TLC plates (Merck) by a Linomat 5 semiautomatic sample applicator (Camag) ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were gently transferred to a 15-mL conical tube (Falcon) containing 8 mL of 4°C RPMI 1640 (ATCC modification) medium supplemented with 10 U/mL DNaseI (Merck). The cryovial was rinsed with 1 mL of the RPMI medium to transfer the remaining NK cells to the 15-mL tube ...
-
bioRxiv - Cell Biology 2024Quote: ... Forty eight hours of post-transfection the viral supernatants were passed through 0.45 μm syringe and the diluted viruses were used to infect cells in growth media supplement with 8 μg/ml of fresh polybrene (Merck) for 8 hr for three consecutive times ...
-
bioRxiv - Molecular Biology 2023Quote: ... then the mixture was dialyzed against histone refolding buffer at 4 □ using a dialysis tube (D-TubeTM Dialyzer Medi or Maxi, MWCO 6-8 kDa, Merck). HE buffer (10 mM HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... fillet dissections of L3 larvae or pharate adults were performed in modified HL3 solution ([HL3-EGTA] 70 mM NaCl, 5 mM KCl, 10 mM NaHCO3, 20 mM MgCl2, 5 mM trehalose (Merck KGaA, 108216), 115 mM sucrose (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by embedding in 5 % low melting agarose (Merck). Gelatinated blocks were washed in 0.1 M Soerensen’s phosphate buffer (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5% (v/v) Donkey serum (Merck Millipore, S30-100ML) for more than 1h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C and samples were eluted with 5 mM H2SO4 in water at a 0.3 ml/min flow rate.
-
bioRxiv - Genetics 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mg/mL Triton X-100 (Merck, X100). Solubilisation was carried at 4 °C for 20 min with mild agitation ...