Labshake search
Citations for Merck :
251 - 300 of 4542 citations for 6 Chloroimidazo 1 2 b pyridazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Cell Biology 2024Quote: ... and counterstained with Fast Green (0.04% w/v in 1% acetic acid, Merck, Darmstadt, Germany).
-
bioRxiv - Genetics 2022Quote: ... or SD complete amino acid agar (0.67% yeast nitrogen base with amino acids (Merck), 2% glucose ...
-
bioRxiv - Microbiology 2020Quote: ... Phases A and B were water (MilliQ, Merck) and acetonitrile (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... using RP select B 125-4 Column (Merck). The chromatography was carried out at a flow rate of 1.5ml/min starting with a mobile phase of 80% methanol and 20% H2O for 3 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Polymyxin B sulfate (Merck Millipore, 10 μg/mL), thymidine (Alfa Aesar ...
-
bioRxiv - Bioengineering 2020Quote: ... on gelatin-coated plates (Merck, #ES-006-B). Such plates were used for Figures 3C and S5B.
-
bioRxiv - Neuroscience 2023Quote: ... polymixin B solution (81271, Merck Life Science S.L.) and dimethyl sulfoxide (DMSO ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... supplemented with 10 μM Palmostatin B (Merck #17851) and Halt phosphatase and protease inhibitor cocktails (ThermoFisher #78440) ...
-
bioRxiv - Molecular Biology 2023Quote: ... To deplete Xrn1 and Dcp2 with the AID tags (Nishimura et al., 2009; Morawska and Ulrich, 2013) 1-Naphthaleneacetic acid (1-NAA; N0640-25G, Merck) was added to a final concentration of 1 mM ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Biophysics 2022Quote: The dyes used in this study and the working dilutions were: 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine (LAURDAN, 4.5 μM, Sigma-Aldrich, Merck, #40227), Hoechst 33342 (80 uM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and formic acid from Merck were used for HPLC separations ...
-
bioRxiv - Physiology 2022Quote: ... Phosphomolybdic Acid Orange G (Merck AG ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.01% pluronic acid (Merck) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 14% acetic acid (Merck). Plates were washed in water ...
-
bioRxiv - Physiology 2019Quote: ... ethylenediaminetetraacetic acid (EDTA) from Merck.
-
bioRxiv - Biochemistry 2019Quote: ... and glacial acetic acid (Merck) (v/v 85:15 ...
-
bioRxiv - Microbiology 2020Quote: ... propionic acid (Merck, Darmstadt, Germany), n-valeric acid (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Pure oxalic acid (Merck, Germany) was identified by the retention time and was quantified by an external standard curve ...
-
bioRxiv - Microbiology 2022Quote: ... L-lactic acid (~90%, Merck), ethanol and glycerol were added to final concentrations of 40 mM ...
-
bioRxiv - Physiology 2022Quote: ... water and formic acid (Merck) in different proportions ...
-
bioRxiv - Cell Biology 2023Quote: ... and L-ascorbic acid (Merck) supplemented with FGF2 (4 ug/mL ...
-
bioRxiv - Immunology 2023Quote: ... and concentrated sulfuric acid (Merck) for at least 30 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Linolenic acid (L2376-500MG, Merck), L-Carnitine hydrochloride (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 150 µM ascorbic acid (Merck), 55 µM β-mercaptoethanol (Thermo Fisher) ...
-
bioRxiv - Genetics 2023Quote: ... folic acid (FA, Merck, #F8758) and 5-methyltetrahydrofolate (5-MTHF ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% Trifluoroacetic acid (TFA, Merck), 1 M glycolic acid (Sigma) ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted peptides were dried in a speed-vac and resuspended in (v/v) 2% acetonitrile/0.2% trifluoroacetic acid (Merck, catalog no. 302031). A total of four biological replicates for each sample type was submitted.
-
bioRxiv - Physiology 2019Quote: ... The hPCLS were treated with 10ng/ml recombinant human TGFß 1 protein (R&DSystems#240-B-010) and 25µM (in 750µl of DMEM) of GM6001 (Merck#CC1010). Lived dead staining was carried out using calcein-am/ ethidium homodimer kit (ThermoFisher#L3224 ...
-
bioRxiv - Plant Biology 2023Quote: ... Acid digestion was performed by adding 9 mL of 69% nitric acid (HNO3) (Suprapur, Merck) and 1 mL of 30% hydrogen peroxide (H2O2 ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Immunology 2023Quote: ... Bacterial cells processed via ultrasound and insoluble inclusion bodies were extracted with 1% deoxycholic acid (Merck) and 1% Triton X-100 (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by 1% acetic acid for 30 seconds and Safranin’O solution for 45 min (S2255, Merck). For immunofluorescence ...
-
bioRxiv - Pathology 2023Quote: ... 1 µl of CAA (400mM 2-Chloroacetamide (#C0267, Merck) was added ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Immunology 2020Quote: Survival was determined by assessing the fraction of vital cells at defined time points during culture by flow cytometric exclusion of 4’,6-Diamidin-2-phenylindol (DAPI) (Merck, Darmstadt, Germany) and Annexin V-APC (BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... α6-integrin (Merck, monoclonal, MAB1378), Laminin V (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6% PEG 4000 (Merck-Schuchardt), pH 5.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...