Labshake search
Citations for Merck :
4851 - 4900 of 5744 citations for Trans Dcca 100 Ug Ml In Acetonitrile D3 1 Carboxyl 13C2 99%;1 D 97% 97% Chemical Purity since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... five individuals were placed in a type-A aluminum planchette (100 µm deep; Wohlwend, article #241) pre-wetted with hexadecene (Merck) and then filled with M9 buffer containing 20% (w/v ...
-
bioRxiv - Plant Biology 2019Quote: ... and fluorescence emission spectra were recorded before (t0) and 60 min (t60) after exchange of solution to either HBSS with 100 µM (±)-ABA (Merck) and 0.1 % EtOH (treatment ...
-
bioRxiv - Developmental Biology 2021Quote: ... The cell pellets were resuspended in PBS+0.5% Triton-X 100 supplemented with Complete™ protease inhibitor cocktail (Merck, USA) and frozen overnight at −80 °C for lysis ...
-
bioRxiv - Biochemistry 2020Quote: ... Chromatographic separation of AAs was achieved by applying 3 μl of dissolved sample on a SeQuant ZIC-HILIC column (3.5 μm particles, 100 × 2.1 mm) (Merck, Darmstadt, Germany), combined with a Javelin particle filter (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and were transferred at 100 mA for 70 min onto PVDF membrane (Immobilon-P, 0.45 μM pore size, Merck Millipore) using semi-dry blotting system ...
-
bioRxiv - Biochemistry 2021Quote: ... A cloudy liposome suspension was freeze-and-thawed 10x and extruded 17x through 100 nm polycarbonate filters (Merck Millipore, USA) to reduce multi-lamellarity and achieve a consistent size distribution of vesicles ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... Extracts were filled into a 100-μl Hamilton syringe and spotted onto silica gel 60 F254 high-performance thin-layer chromatography (HPTLC) plates (Merck) with a Linomat 5 sample application unit (Camag ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were sacrificed at 110 days old via i.p anesthesia administration of 100 mg/kg Ketamine (Fort Dodge, USA) and 20mg/kg Xylazine (Merck, Germany) following trans-cardial perfusion with saline ...
-
bioRxiv - Biophysics 2022Quote: ... The elution volume of 60-70 mL was collected and the solution was concentrated to a volume of 200 μL with an Amicon Ultra-15 PLHK Ultracel-PL Membrane 100 kDa (Merck) spin column ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM stock solution was prepared by dissolving ROCKi powder in 100% dimethyl sulfoxide (DMSO, Merck Life Science, UK, #D8418) and filtered through 0.22µM syringe filters ...
-
bioRxiv - Plant Biology 2021Quote: ... USA) was conditioned with 1ml of 100% methanol and 1ml of deionized water (Milli-Q, Merck Millipore, Burlington, MA, USA). After the conditioning steps each sample was loaded on SPE column and flow-through fraction was collected together with the elution fraction 1ml 30% aqueous acetonitrile (v/v) ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 1 h at 50 V followed by 3.5 h at 100 V and blotted on PVDF-membranes (Immobilon-PSQ Membrane, Merck Millipore). Incorporation of [35S]-methionine into newly synthesized proteins enabled the detection of translation products by phosphor imaging (exposure time of 1 day).
-
bioRxiv - Microbiology 2021Quote: ... were collected from the top of the gradient and the fraction material was cleaned by washing three times and resuspended in 0.02 µm-filtered FSW using 100 kDa Amicon-ultra filters (Merck Millipore). Vesicles were detected in fractions with densities of 1.05–1.07 g ml−1 (fractions 3-5 from the top).
-
bioRxiv - Bioengineering 2020Quote: ... and 100 μl dispensed in triplicate into wells of 96-well ELISA plates (Nunc Maxisorp; Merck Ltd., Poole, United Kingdom) preblocked with 1w/v BSA in PBS and precoated with monoclonal anti–IFN-γ (U-Cytech ...
-
bioRxiv - Microbiology 2022Quote: ... A 100 µl subsample of each dilution was plated onto yeast mannitol agar (YMA; Sigma Aldrich, Merck KGaA, Darmstadt, Germany) supplemented with Congo red ...
-
bioRxiv - Biophysics 2019Quote: ... the DNA-conjugated GNPs were separated from an excess amount of oligonucleotide by 100 kDa MWCO filters (Amicon Ultra, MERCK) with TE buffer added to the filter ...
-
bioRxiv - Genomics 2019Quote: ... for 1 hour at 50 V followed by 3.5 hours at 100 V and blotted on PVDF-membranes (Immobilon-PSQ Membrane, Merck Millipore). Incorporation of [35S]-methionine into newly synthesized proteins enabled the detection of translation products by phosphor imaging (exposure time of 1 day).
-
bioRxiv - Plant Biology 2019Quote: ... Cells were then lysed in lysis buffer (50 mM KHPO4 pH 8, 100 mM NaCl, 10 mM Imidazole, 1X BugBuster (Merck), 25 U/ml Benzonase nuclease ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Chromatographic separation was carried out on an Agilent 1200 series quaternary HPLC system using a Chromolith Performance RP18-e column (100×3 mm) from Merck operated a temperature of 45°C with 1 mM ammonium formate in water containing 0.1% FA as mobile phase A and 1 mM ammonium formate in 95/5 (vol/vol ...
-
Revisiting a GWAS peak in Arabidopsis thaliana reveals possible confounding by genetic heterogeneitybioRxiv - Genetics 2021Quote: ... 2 µl of each sample was injected into a SeQuant ZIC-pHILIC HPLC column (Merck, 100 × 2.1 mm; 5 µm), and the respective guard column operated with an Ultimate 3000 HPLC system (Dionex ...
-
bioRxiv - Immunology 2020Quote: ... MS2-FP8 VLPs were concentrated from SEC purified fractions by ultra-centrifugal filtration using Amicon® Ultra-15.0mL 100 K membrane (Merck Millipore Ltd. ...
-
bioRxiv - Immunology 2021Quote: ... neuraminidase-specific inhibitor DANA was added to a final concentration of 100 μM (N-Acetyl-2,3-dehydro-2-deoxyneuraminic acid, Merck, USA). It was used for 48 h prior stimulus.
-
bioRxiv - Bioengineering 2022Quote: ... samples were blocked and permeabilized with 2% BSA and 0.1% Triton X-100 (#9036-19-5, Sigma-Aldrich now Merck) in PBS for 30 minutes at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... The whey supernatants were concentrated by centrifugation at 4,000 x g at 20°C using Amicon 100-kDa centrifugal filter units (Merck Millipore) to a final volume of ∼6 mL ...
-
bioRxiv - Bioengineering 2022Quote: ... were rinsed with PBS and incubated in 500 μL of cell lysis solution containing 0.2% (v/v) Triton-x-100 (Merck, 1.08603.1000) in 5 mM MgCl2 (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2022Quote: ... Peak fractions were pooled for mass spectrometric analysis and concentrated with an Amicon Ultra – 0.5mL 100-kDa cut-off centrifugal filter unit (Merck Millipore) for cryo-EM sample preparation (1.7 mg ml-1 Cav1.2(ΔC)/Cavβ3 sample or 2.7 mg/ml Cav1.2(DC)/Cavβ3/Cavα2δ sample).
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 µl of sample were transferred into 100 µl of Amido-Black-Staining solution (0.25 % (w/v) Amido black 10 B (Merck, #1011670025)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The cloudy mass of sperms was pulled away from the epithelial layer using the needle and transferred into a 1.5 ml microfuge tube kept on the ice having 100 μl of 1X PBS containing 1X protease inhibitor cocktail (PIC) (cOmplete EDTA-free, Merck). The sperms isolated from 75-100 male flies were used for further processing.
-
bioRxiv - Plant Biology 2022Quote: ... 100 μg of each sample was placed in an Amicon ultrafiltration centrifuge tube (Merck, 10 kD molecular weight cut-off), 120 μL reductant buffer (10 mM DTT ...
-
bioRxiv - Microbiology 2022Quote: ... ZIKV was concentrated using an Amicon Ultra-15 Centrifugal Filter Unit with an Ultracel-100 membrane (Merck Millipore, Darmstadt, Germany).
-
bioRxiv - Physiology 2022Quote: ... They were then permeabilized with 0.02% Triton X-100 in PBS for 15 min and blocked with 5% bovine serum albumin (Sigma-Aldrich, Merck) in PBS for 3 h ...
-
bioRxiv - Microbiology 2022Quote: ... fixed with cold methanol for 5 min and permeabilized with PBS containing 0.1% Triton X-100 (Merck Life Science, T8787). For the staining of acidic organelles ...
-
bioRxiv - Cancer Biology 2024Quote: ... The supernatant was removed by placing samples on a magnetic stand, the beads were resuspended in 100 μL of Antibody buffer (Wash buffer, 0.025% Digitonin (Merck, 300410), EDTA 2 mM ...
-
bioRxiv - Molecular Biology 2024Quote: ... was filtered through a 0.45 μm syringe filter and 50-60× concentrated using Amicon Ultra-15 100 kDa NMWCO columns (#UFC910024, Merck Millipore). The resulting concentrate was aliquoted and stored at -80°C until further use.
-
bioRxiv - Cancer Biology 2023Quote: ... Cell culture supernatants from 4950T or 170162T cells were concentrated 10x using Amicon centrifugal filtration units with 100 kDa cutoff filter (Merck). Concentrated supernatant or glycodelin A isolated from amniotic fluid was added to the lectin coupled beads and incubated overnight on an overhead shaker at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... leaf punches were taken with a 4-mm biopsy punch and floated in 100 μL of H2O with 20 μM coelenterazine (Merck), using individual cells of a white 96-well white bottom plate (Greiner F-Boden ...
-
bioRxiv - Biochemistry 2024Quote: ... The synthesized cGMP was quantified by means of HPLC using a C18 reverse phase column (LiChrospher 100 RP-18, Merck). Data are reported as the mean ± standard deviation of at least three data sets.
-
bioRxiv - Biophysics 2024Quote: ... The protein was concentrated to 60 µM – 100 µM using an Amicon Ultra Centrifugal Filter Unit (30 kDa MWCO, Merck) and stored at −80 °C.
-
bioRxiv - Microbiology 2023Quote: ... tricornutum PT15 Xenic Minus nitrate (0 µM) 100 µL of an aqueous 15N- L-valine-solution (98 atom % 15N, Merck, Saint Louis ...
-
bioRxiv - Biophysics 2024Quote: Glass coverslips (Paul Marienfeld GmbH, 24 x 50 mm, 170 ± 5 μm) were overnight incubated in 100 mM Sulphuric acid (Merck). Afterwards the coverslips were rinsed consecutively with Milli-Q water ...
-
bioRxiv - Immunology 2023Quote: ... Cells were transferred to plates, and then washed in 100-200 μL FACS buffer (PBS containing 2% FCS, 2 mM EDTA (Merck) and centrifuged at 400 x g for 5 mins ...
-
bioRxiv - Immunology 2023Quote: ... The tetramer (428 kDa) was purified from excess GFP-biotin (25 kDa) with a 100 kDa cut-off Amicon Ultra centrifugal filter (Merck). Functionalised agarose beads were washed twice and then incubated with 20 nM of the GFP-streptavidin tetramers and anti-mouse IgG2a/b BV421 antibody (1:10 dilution ...
-
Neuron-astrocyte metabolic coupling facilitates spinal plasticity and maintenance of persistent painbioRxiv - Neuroscience 2022Quote: ... the sections were equilibrated to room temperature and then washed twice for 5 minutes (min) in PBST (0.1% Triton X-100 (Merck, #108603)/PBS) ...
-
bioRxiv - Microbiology 2023Quote: ... and lysed in SDS sample buffer containing 100 mM DTT before protein separation on precast Bis-Tris polyacrylamide gels (MPAGE; Merck) and transferred to nitrocellulose membranes by electroblotting ...
-
bioRxiv - Microbiology 2023Quote: The dissolved inorganic carbon concentration needed for the calculation40 was determined using the CaCO3 Merck Spectroquant kit (No. 1.01758.0001) and the Merck Spectroquant Pharo 100 spectrophotometer (Merck, Schaffhausen, Switzerland).
-
bioRxiv - Biochemistry 2023Quote: Cancer cells were seeded at a density of 1,000 cells/ 100 μL complete medium into 96-well cell culture plates (#655180, Greiner bio-one, Merck KGaA). After 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Target cells without effectors served as a negative control and target cells incubated with 2% Triton X-100 (Merck-Sigma) served as positive control (maximum killing).
-
bioRxiv - Molecular Biology 2023Quote: ... equipped with a LiChrospher® 100 RP-18 (125 mm x 4 mm, 5 µm) C18 reversed-phase column (Merck). The elution solvents consisted of ultrapure water with 0.1% formic acid (A ...