Labshake search
Citations for Merck :
4551 - 4600 of 4915 citations for Human Interleukin 1 Family Member 10 IL1F10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized using the qScript cDNA SuperMix (Quantabio) from 1 μg total RNA previously treated with DNase I (Merck). For droplet generation ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Sections containing SN and VTA were incubated with antibodies directed against tyrosine hydroxylase (mouse monoclonal, 1:1000, Merck-Millipore MAB318) and mCherry (rabbit polyclonal ...
-
bioRxiv - Genomics 2021Quote: Cultures of three Lasiodiplodia and five Neofusicoccum species (Table 1) were inoculated onto cellophane covered 2 % malt extract agar (MEA; Biolab, Merck) and incubated at 22 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The following day cancer cells were serum-deprived for 24h and then all cell lines were treated either with camptothecin 1-10μM (ref. C9911, CPT; Sigma-Merck, Argentina) or DMSO (ref ...
-
bioRxiv - Biophysics 2020Quote: ... The main peak fractions were pooled and concentrated to ∼1 mg/ml using an Amicon Ultra 100K filter (Merck Millipore).
-
bioRxiv - Cell Biology 2021Quote: Cells were lysed and scraped in homemade Radioimmunoprecipitation assay buffer (RIPA) ((50 mM Tris pH 7.4, 150 mM NaCl, 1 % Triton X-100 (Merck, T9284), 2 mM EDTA ...
-
bioRxiv - Cell Biology 2021Quote: ... Spleen cells isolated from the mouse with the best serum titre were fused with Sp2/0 cells in the ratio of 5:1 using polyethylene glycol (PEG) 3000 (#817019, Merck). 10 million cells of the fusion mix were combined with 2x 104 BALB/c peritoneal macrophages and seeded in a 96-well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membrane was incubated with secondary antibody for 1 hour at room temperature and proteins were detected using chemiluminescent HRP substrate (Merck-Millipore ...
-
bioRxiv - Microbiology 2022Quote: ... and non-expressing (d2EGFP−) cells were seeded into a 96 well plate pre-coated with 1 mg/ml Poly-D-Lysine (PDL, Merck). Aryl hydrocarbon receptor (AhR ...
-
bioRxiv - Cell Biology 2022Quote: ... for 1 h at room temperature (RT) and revealed by chemiluminescence using Immobilon Crescendo or Forte Western HRP substrate (Millipore Merck).
-
bioRxiv - Microbiology 2022Quote: ... The membranes were blocked and incubated with primary antibodies against bornavirus P (1:500) and α-tubulin (Merck, Darmstadt, Germany), followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch ...
-
bioRxiv - Biophysics 2022Quote: ... For the valine-labeled sample ketoisovalerate was added to a final concentration of 40 mg L-1 together with deuterated leucine (Merck) to a final concentration of 25 mg L-1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Explants were cultured in 35 mm tissue culture dishes pre-coated with poly-L-lysine (20 µg/ml for 1 hr; Merck) and laminin (20 µg/ml for 1 hr ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell debris was removed by centrifugation at 15k g for 1 min and 1 µl of the supernatant was used as template DNA for 25 µl PCR reaction (KOD HotStart, Merck) with primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... “treated” cultures were grown with the addition of 0.25 µg ml-1 mitomycin C (MMC) (Merck Life Sciences UK Ltd). Mycelial pellets from untreated and treated cultures were washed in 1x PBS before lysis and RNA purification using the RNEasy Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... the Milliplex SARS-CoV-2 Antigen Panel 1 IgG was used according to the manufacturer’s instructions (Merck Millipore, Darmstadt, Germany).
-
bioRxiv - Biophysics 2019Quote: ... Oryzalin-treated inflorescence meristems were obtained from plants grown on custom-made Arabidopsis medium (40) (Duchefa) supplemented with 1% agar-agar (Merck) and 10 µM N-1-naphthylphthalamic acid (NPA ...
-
bioRxiv - Microbiology 2019Quote: ... and the pellet was resuspended in 0.1 M sodium acetate buffer (pH. 6) and dialysed against four changes of buffer using Amicon ultra centrifugal filters (Merck, Millipore ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All culture media were supplemented with either 20 g L−1 of D-glucose or maltose (both from Merck Millipore).
-
bioRxiv - Molecular Biology 2019Quote: ... followed by washing and staining with horseradish peroxidase-conjugated donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5,000 dilution; Merck Millipore), respectively ...
-
bioRxiv - Plant Biology 2020Quote: ... The inoculum concentration was adjusted to 106 spores mL-1 and the resulting spore suspension was supplemented with 0.1 % of Tween 20 (Merck, UK) prior to inoculation in the field ...
-
bioRxiv - Genetics 2021Quote: In vitro treatments were carried out with different compounds: 1 μM MG-132 24 hours or 3 hours (Merck Millipore), 20 μM Chloroquine (CQ ...
-
bioRxiv - Molecular Biology 2021Quote: Whole kidneys were homogenised in 250 mM sucrose / 20 mM triethanolamine with protease inhibitors (1% Merck Protease Inhibitor Cocktail III). The homogenate was cleared of large debris by centrifugation at 4000 g for 15 mins at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mg of total protein at a 1 mg/ml concentration was incubated with 40 µl anti-FLAG-M2 affinity resin (Merck) (which had been blocked overnight with 1% BSA and 5 µl/ml ssDNA ...
-
bioRxiv - Cancer Biology 2021Quote: Primary HPMECs in EBM2 medium or ST1.6R cells in DMEM/1% FBS were cultured overnight and stimulated with 2 μg/ml of recombinant TNC (Merck Millipore) for 24 h ...
-
bioRxiv - Plant Biology 2019Quote: ... 2.5 mM desthiobiotin [IBA]) and concentrated to a final volume of about 1 mL using Amicon Ultra-4 30 K filters (Merck). Purity of proteins was analyzed by SDS-PAGE using 10 % Mini-PROTEAN® TGX™ Precast Gels (BioRad ...
-
bioRxiv - Neuroscience 2021Quote: ... They were then incubated in 1 mL of filtered Sudan Black B working solution (0,036 % (w/v) Sudan Black B (Merck, 15928), 0.1 % phenol ...
-
bioRxiv - Biophysics 2021Quote: ... coli NA2232 grown in a M9 minimal medium supplemented with 2g/L of 13C-D-glucose (Cortecnec, France) and 1 g/L of 14N-ammonium chloride (Merck) as sole carbon and nitrogen sources ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374, used at 1:10,000 for the Western blot analyses, Merck Millipore); a rabbit anti-LC3B polyclonal antibody (#2775 ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellet of 1 mL lysed with Bug Buster (pellet sample) (Bug Buster® Master Mix, Novagen® Merck). For lysis ...
-
bioRxiv - Biochemistry 2021Quote: ... were transformed into Escherichia coli BL21-DE3-pLysS and expressed in 3 x 1 litre of Lucia Broth medium (Merck) supplemented with 100µg/ml ampicillin (Formedium) ...
-
bioRxiv - Biochemistry 2021Quote: ... Lipids containing [6-3H]GlcN-PI were dissolved in 100 μL of chloroform: methanol (2:1, by volume) and loaded to a high performance thin-layer chromatography (HPTLC) plate (Merck). The [6-3H]GlcN-PI was located by phosphorimaging ...
-
bioRxiv - Immunology 2020Quote: ... After washing and incubation with unbuffered DMEM containing 25 mM D-Glucose (Carl Roth, Karlsruhe, Germany) and 1 mM Pyruvate (Merck) for 1h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... A was 1 mM ammonium formate pH 9 (for lincomycin detection, prepared by titration of formic acid 98–100%, Merck, Germany with ammonium hydroxide 28–30% ...
-
bioRxiv - Plant Biology 2021Quote: ... Each MS medium was made by adding 1 bag of MS salt mix (Nihon pharmaceutical CO., LTD.) into the proper volume of milli-Q (Merck) water ...
-
bioRxiv - Microbiology 2019Quote: ... 1) were cultivated according to species-specific cultivation requirements on tryptic soy agar (TSA, ReadyPlate TSA ISO, Merck Life Science) or Middlebrook agar produced in-house ...
-
bioRxiv - Immunology 2020Quote: ... The sections were blocked in PBS containing 1% bovine serum albumin (BSA) for 1 h at RT and stained in blocking buffer containing primary antibody (anti-PP6C, Merck Millipore cat ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by 2h incubation with Alexa Fluor-488 goat anti-rabbit IgG secondary antibody (1:500, A11008, Merck Millipore, MA). Slices were transferred to glass slides and covered with Fluoromount (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% BR + 20% goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Merck) in the blocking buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs (1.5 × 105) were transfected with 25 pmol of target siRNA or non-target siRNA (MISSION siRNA universal control#1, Merck) using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1-oleoyl-2-acetyl-sn-glycerol (OAG) and 4α-phorbol 12,13-didecanoate (4α-PDD) were obtained from Merck (Gillingham, UK). Sphingosine-1-phosphate (S1P ...
-
bioRxiv - Neuroscience 2021Quote: ... MDMi cells were incubated with a primary antibody against Iba1 (1:1,000; 019-19744, FUJIFILM Wako Chemicals) in blocking buffer (2% bovine serum albumin, 0.1% TritonX100 (Merck, Darmstadt, Germany), and 5% normal donkey serum (017-000-121 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was eluted from the filter with 2 x 50 µl of Elution Buffer and 1 x 50 µl with DEPC-treated Molecular Biology Grade water (Merck). RNA samples were quantified with NanoDrop 2000 Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with MISSION® SiRNA oligomers or MISSION® siRNA Universal Negative Control #1 (Sigma Aldrich, Merck, USA) at a final concentration 20 nM ...
-
bioRxiv - Biochemistry 2022Quote: ... lysates were incubated with anti-HA agarose beads (20 μl of beads per 1 mg of proteins) (Merck, Darmstadt, Germany) for 2 h ...
-
bioRxiv - Immunology 2022Quote: Decidual cells were isolated as described above and incubated in the presence of fluorescence-labeled latex beads (50 beads per cell; latex beads, 1 µm, carboxylate-modified polystyrene, fluorescent yellow-green, Merck) for 2 hours at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sections were washed and incubated overnight at 4°C with anti-Digoxigenin-AP antibody (45-11093274910 Merck-SIGMA, 1:1000). Staining was achieved by adding a solution of 4-Nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Genetics 2022Quote: ... Transient transfection was carried out in HEK293T cells transfected with 1 μg of plasmid DNA in the presence of X-tremeGene9 DNA transfection reagent (#6365809001, Merck), according to the manufacturer’s instructions ...