Labshake search
Citations for Merck :
401 - 450 of 1284 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mg/ml collagenase P (Merck), 1 mg/ml collagenase B (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2024Quote: ... TSC (10 g/L) and citric acid (10 g/L) solutions were prepared in deionized (DI) water (Millipore Milli-Q®, Merck Life Science BV, Belgium) and filtrated through a 0.2 µm pore-sized syringe filter (Sarstedt ...
-
bioRxiv - Neuroscience 2022Quote: ... directed against N-terminal epitopes and rabbit p-Ser491 Dab1 antibody (AB9642) were from Merck Chemicals (Darmstadt ...
-
bioRxiv - Biophysics 2019Quote: ... at a concentration of 0.15-25 mg/ml in n-pentane (MERCK KGaA, Darmstadt, Germany).
-
bioRxiv - Cell Biology 2021Quote: ... in 20 mL 1 N HCl) and Solution B (0.5 g Ammonium molybdate (277908, Merck) in 7 mL 4 N HCl ...
-
bioRxiv - Microbiology 2020Quote: DNA extraction was carried out using the REDExtract-N-Amp™ tissue kit (Merck, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Embryos used for imaging were transferred to E3 with 0.003% N-phenylthiourea (PTU-E3, Merck) at 24 hpf to inhibit pigmentation ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated o/n at 4°C with the primary antibodies (Rabbit-antiGFAP: MAB3402, Merck Millipore ...
-
bioRxiv - Molecular Biology 2024Quote: ... clones were transferred to liquid Brock medium (0.1% (w/v) N-Z-amine (Merck, Germany) and 0.2% (w/v ...
-
bioRxiv - Biophysics 2023Quote: ... SK-N-BE cells expressing LAMP1-eGFP are treated with 10 µg/mL nocodazole (Merck) for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... yolk sac or tail of embryos with the REDExtract-N-Amp Tissue PCR kit (Merck) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 200µM of 1-phenyl-2-thiourea (PTU, ref. n°P7629, Merck/Sigma-Aldrich) to avoid pigmentation ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with anti-EM48 primary antibody (1:100; Merck Millipore, cat n° MAB5374) for 3h at RT ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The embryos were then incubated with anti-cleaved caspase 3 pAb (1:100) (Anti-caspase-3, cleaved (Ab-2) Rabbit pAB (PC679; Merck) followed by a wash and a second incubation with anti-rabbit 568 ...
-
bioRxiv - Cancer Biology 2019Quote: ... streptomycin (100 U/ ml) and L-glutamine (4 mM) (Merck, G3126), pH 7.4 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (all Merck). The oxygen consumption rate (OCR ...
-
bioRxiv - Neuroscience 2022Quote: ... H & L Chain Specific Peroxidase Conjugate antibody (Merck Cat# 401315, RRID:AB_2617117). Secondary antibodies for detecting immunoprecipitated proteins are as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were exposed (or not) to 25 μmol/L metformin (Merck, Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... on poly-L-lysine coated glass slides (Sigma Merck, P0425-72EA). The edges of the slides were sealed with nail polish ...
-
bioRxiv - Plant Biology 2022Quote: ... rubella plants were selected with glufosinate (75 mg/l; Merck, USA) spray ...
-
bioRxiv - Neuroscience 2023Quote: ... Buffers were pretreated overnight with diethylpyrocarbonate (DEPC; Merck; 1 ml/L) and autoclaved or prepared using DEPC-treated and autoclaved water as diluent ...
-
bioRxiv - Biophysics 2023Quote: ... 0.5 mM EDTA and 0.5 mg/ml L-cysteine (#30090, Merck), in DMEM ...
-
bioRxiv - Physiology 2023Quote: ... Merck) or NADPH 0.3 mmol/L (NADPH, Tetrasodium Salt, 481973, Merck).
-
bioRxiv - Neuroscience 2023Quote: Microglia were cultured in a poly-L-lysine (PLL; Merck, Germany) coated 96-wells flat bottom plate (Greiner Bio-One ...
-
bioRxiv - Neuroscience 2023Quote: ... Buffers were pretreated overnight with diethylpyrocarbonate (DEPC; Merck; 1 ml/L) and autoclaved or prepared using DEPC-treated and autoclaved water as diluent ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 50 μM 2-Phospho-L-ascorbic acid (Merck, 49752). Frozen stocks were prepared at passage 4 and used for all subsequent experiments ...
-
bioRxiv - Microbiology 2024Quote: ... India) or glucose (10 g L-1 D-glucose, Merck, Germany), under anaerobic condition ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...