Labshake search
Citations for Merck :
451 - 500 of 1284 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3-NT (1:1000, 06-284, Merck) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3-NT (1:1000; 06-284, Merck). Following primary antibody incubation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2021) using buffers supplemented with 5 mM of the deubiquitinase inhibitor N-ethylmaleimide (Merck Life Science) for H2AK119ub1 ChIP ...
-
bioRxiv - Biochemistry 2020Quote: We obtained mevastatin (M2537), mevalonate (50838) and N-acetyl-leucinyl-leucinyl-norleucinal (ALLN, 208719) from Merck, Germany ...
-
bioRxiv - Microbiology 2020Quote: ... In experiments including the reversible cysteine protease inhibitor N-acetyl-Leu-Leu-Norleu-al (ALLN) (Merck), parasite lysates were pre-incubated with 10 µM of the inhibitor for 30 min prior to addition of the ABP for a further 15 min ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Microbiology 2024Quote: ... The chromatic mutants were mixed in different ratios (1:1, 1:3, 3:1) and the mixtures were fixed using 4% paraformaldehyde (Sigma−Aldrich/Merck, Germany) for 4 h at 4°C.
-
bioRxiv - Developmental Biology 2021Quote: ... and cryosections were placed on poly-L-lysine coated glass slides (Merck). The slides were stored directly at −80 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2.5mM L-Aspartate) and concentrating with 30 MWCO Amicon Ultra-15 (Merck) to the starting volume ...
-
bioRxiv - Plant Biology 2020Quote: ... and eluent B: 500 mmol/L NaOH solution (Merck KGaA, Darmstadt, Germany). An isocratic elution procedure of 60% A and 40% B at the flow rate of 2.0 mL/min was used for chromatographic analysis ...
-
bioRxiv - Microbiology 2022Quote: ... 100 mg L−1 hydrogen peroxide (reagent grade 35% w/v, Merck) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM, Merck, A7007) used as a primary methyl donor molecule ...
-
bioRxiv - Microbiology 2022Quote: ... Mice were administered with 4 mg/L of dexamethasone (Merck, Lyon, France) through drinking water ...
-
bioRxiv - Immunology 2022Quote: ... Samples for immunofluorescence analysis were seeded onto poly-L-lysine (Merck, #P1274)-coated slides (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... 55 mmol L-1 NaCl (Merck KGaA, pH 8.2; T = −27 °C). The mixture was immediately vortexed for 4 seconds and rapidly filtered through cellulose acetate filters (0.45 μm ...
-
bioRxiv - Zoology 2021Quote: ... all fish were anaesthetized (ethyleneglycol-monophenylether, Merck, 0.2-0.5 mL L-1), photographed on the left side and scanned for ID recognition (Fragkoulis et al ...
-
bioRxiv - Plant Biology 2022Quote: ... coated with 0.01% poly-L-lysine (Merck Life Science UK, Gillingham, Dorset) to promote cell adhesion to the glass surface ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1:20’000) and goat anti-rabbit IgG (Merck Millipore AP307P, (H+L) HRP conjugate ...
-
bioRxiv - Neuroscience 2022Quote: ... Italy) pre-coated with 500 µg·ml−1 poly-L-lysine (#P4707, Merck) and 0.01 mg·ml−1 laminin (#L2020 ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were dissociated with accutase and replated onto poly-L-ornithine (Merck) or polyethyleneimine (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... poly L-lysine (MW 30-70 kDa) and invertase were from Merck Life Science UK Ltd ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 nM 3,3′,5-Triiodo-L-thyronine sodium salt (Merck, cat. #T6397), and 1% penicillin-streptomycin (Merck ...
-
bioRxiv - Microbiology 2023Quote: ... LB was supplemented with 100 mg L-1 ampicillin (Merck, Darmstadt, Germany). E ...
-
bioRxiv - Plant Biology 2023Quote: ... coated with 0.01% poly-L-lysine (Merck Life Science UK, Gillingham, Dorset) to promote cell adhesion to the glass surface ...
-
bioRxiv - Cell Biology 2023Quote: ... and 230 µl of the 9 mol/L sulphuric acid (Merck Millipore) was added and mixed ...
-
bioRxiv - Biophysics 2022Quote: ... 100 μl of 50 mM Cysteine (L-Cysteine for biochemistry from Merck) and 200 μl of (in 10 μg/mg mAb concentration ...
-
bioRxiv - Biophysics 2023Quote: ... cells were grown overnight on poly-L-lysine-coated coverslips (#P2658, Merck).
-
bioRxiv - Immunology 2022Quote: ... Larvae were kept in egg medium with 20 mg/l phenylthiourea (Merck) from 22 hpf to avoid pigmentation ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were grown on poly-L-lysine (Merck-Millipore, Burlington, MA, US) coated glass coverslips in a 1:1 ratio ...
-
bioRxiv - Biochemistry 2024Quote: ... + 10% heat-inactivated Fetal Bovine Serum (Eurobio) + 2 mM L-Glutamine (Merck) + 1% Penicillin/Streptomycin ...
-
bioRxiv - Immunology 2024Quote: Drinking water was supplemented with L-asparagine monohydrate (Merck, cat: A7094-25G) at 1.5 g/L and administered to mice two weeks prior to immunisation and maintained for the whole duration of the experiment ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Biophysics 2022Quote: ... CAFs (Vitro Biopharma Cat. n. CAF08) were cultured in DMEM medium (D5671, Sigma-Merck KGaA, Darmstadt, Germany) supplemented with 10% FBS (F7524 ...
-
bioRxiv - Bioengineering 2022Quote: ... in Cytoskeleton Buffer (CB, 10 mM 4-Morpholineethanesulfonic acid,2-(N-Morpholino)ethanesulfonic acid (MES #M3671, Merck), 138 mM KCl (#6781 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pre-cultures were cultivated in Brock medium supplemented with 0.1% (w/v) N-Z-amine (Merck, Germany) and 0.2% (w/v ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-phosphorylated (Ser897)-N-methyl-D-aspartate receptor (anti phosphoNMDAR cat.#ABN99, Merck Millipore, Burlington, MA, USA), anti-total-calcium/calmodulin-dependent protein kinase II (anti-tCaMK ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Bioengineering 2019Quote: ... molecular weight cut-off 3 kDa (Amicon®, Merck) to a concentration of 1 mg/mL as determined by Qubit Protein Assay Kit (Invitrogen™ ...
-
bioRxiv - Biochemistry 2020Quote: ... using 3 kDa MWCO Amicon centrifugal filters (Merck Millipore). For protein denaturation ...