Labshake search
Citations for Merck :
401 - 450 of 4636 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... samples were fixed in a solution of 4 % (v/v) paraformaldehyde supplemented with 1 % (v/v) glutaraldehyde (Merck, USA) overnight at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 2 % (vol/ vol) FCS and and 10 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, Merck) and cut into 1 cm pieces ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were probed overnight at 4°C with anti-phosphotyrosine antibody (1/1000, 05-321, clone 4G10, Merck Millipore) in blocking solution ...
-
bioRxiv - Immunology 2022Quote: ... The sections were incubated overnight at 4°C with the following primary antibodies: KRT8 (Merck Millipore, MABT329, 1:100), p-ERK (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2023Quote: ... concentration and buffer exchange to TE (10 mM Tris-HCl pH7.5 and 1 mM EDTA) with an Amicon Ultra-4 centrifuge filter unit42 (30 kDa cut-off, Merck). Concentration of all plasmids was measured by NanoDrop One (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated for 24 h at +4°C with primary antibodies (goat anti-Chat (1:200, Merck, AB144P), mouse anti-GFAP (1:300 ...
-
bioRxiv - Physiology 2024Quote: ... Membrane was incubated overnight at 4°C with specific mouse monoclonal primary antibody anti-puromycin (Merck, MABE343, 1:1000) and after wash ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by overnight incubation at 4°C with 250µl of the anti-DIG antibody (Merck #11093274910 diluted 1:2000) and other necessary primary antibodies (when additional immunostaining was needed ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μL (equivalent to 3 mg cell dry weight) were spotted on HPTLC silica gel 60 plates (Merck) and developed in chloroform/methanol/13 M NH3/1 M NH4Ac/water (180:140:9:9:23 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 105 Cas9 TNG MKOS MEFs were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed in PBS for 3 times and Alexa Fluor 555 conjugated secondary goat anti-mouse IgG antibody (1:100; Merck, Germany) was added for immunostaining in the dark for 2 hours at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of Protein powder solutions (1 mg/ml) were added to 3 cm NG plates with 10 µM 5-FU (Merck, #F6627). After the plates had dried ...
-
bioRxiv - Bioengineering 2024Quote: ... The activated microgels were then resuspended in 3 mL of PBS and 50 µL of 100 U mL−1 thrombin (Merck T1063) and stirred at room temperature overnight ...
-
bioRxiv - Genomics 2020Quote: ... Teratomas that developed within 4 weeks post-injection were harvested and fixed in 4% paraformaldehyde (Merck), embedded in paraffin ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed using 4% paraformaldehyde (Merck, 1040051000) in PBS and permeabilized by CSK buffer (25 mM HEPES pH 7.8 ...
-
bioRxiv - Genetics 2021Quote: ... fixed with 4% paraformaldehyde (PFA, Merck) in PBS (pH = 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... and fixed in 4% paraformaldehyde (Merck) overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/ml heparin (Sigma/Merck), 20 ng/ml EGF (Peprotech) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 4 g/l thiamine-HCl (Merck), and 40 g/l myo-inositol (Merck) ...
-
bioRxiv - Genomics 2020Quote: ... and Tubulin beta 4 (#T7941, Merck). To do so ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 mM glutamine (Merck KGA, Germany), 1 mM sodium pyruvate (Merck KGA ...
-
bioRxiv - Microbiology 2024Quote: ... were fixed with 4% formaldehyde (Merck) diluted in PBS 1X for 10 min at room temperature and then washed 3 times with PBS 1X ...
-
bioRxiv - Bioengineering 2023Quote: ... MOWIOL 4-88 Reagent (475904, Merck); LysoTracker Deep Red (L12492 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-Hydroxytamoxifen (4OHT) (Merck Sigma-Aldrich) was added at a final concentration 100 nM for 10-12 hours to induce the recombination of the Lynflallele.
-
bioRxiv - Neuroscience 2023Quote: ... followed by 4 % PFA (1004005, Merck) (w/v ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 μg/mL PI (Merck, Germany) and 12 μg/mL Hoechst 33342 (Miltenyi Biotec ...
-
bioRxiv - Bioengineering 2024Quote: ... MOWIOL 4-88 reagent (475904, Merck); High Pure RNA Isolation Kit (11828665001 ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μl 40 mM glucose-6-phosphate (Sigma-Aldrich, now Merck KGaA) and 20 μl 35 mM NADP+ (KMF OptiChem ...
-
bioRxiv - Bioengineering 2020Quote: ... insulin (n=6; 20 U, Vetsulin, Merck Animal Health, Madison, NJ, USA), 2-deoxy-D-glucose (n=6 ...
-
bioRxiv - Immunology 2021Quote: ... mature macrophages (n=6 individual donors) were detached using Accutase (Merck Millipore), blocked with 10% pooled human serum in PBS for 30 minutes and incubated with various concentrations of rRABV-tG (0-100 μg/mL ...
-
bioRxiv - Plant Biology 2024Quote: ... and 0.36 U glucose-6-phosphate dehydrogenase (G6PDH) (G7877; Sigma-Aldrich/Merck) to each tube ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.2 mL of a 0.2 M acetylacetone (Merck, cat# 123—54-6) solution was added to the former solution and kept in a water bath at 70°C for 10 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Supernatants were loaded to HybridSPE-Phospholipid cartridges (500 mg/6 mL, Merck) prewashed with 12 mL MeOH and 12 mL ACN containing 0.5% CA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 53.29 mM D-(+)-xylose (Merck/Sigma-Aldrich, CAS number : 58-86-6), 49.37 mM sodium succinate dibasic (Merck/Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...