Labshake search
Citations for Merck :
4251 - 4300 of 5744 citations for Trans Dcca 100 Ug Ml In Acetonitrile D3 1 Carboxyl 13C2 99%;1 D 97% 97% Chemical Purity since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... followed by incubation in LI-COR blocking buffer containing rabbit polyclonal anti-P2X2 (#APR-003, Alomone labs; 1:2000) and mouse anti-Na+/K+-ATPase (05-369; EMD Merck Millipore) at 4 °C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... The binding of CoVHH1-FLAG to S1 subunits-His tag was detected by incubating for 1 hour at room temperature with mouse monoclonal ANTI-FLAG® M2-Peroxidase (Merck) diluted with PBST ...
-
bioRxiv - Neuroscience 2021Quote: ... and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4, Merck KGaA, Germany) in 0.05 M sodium borate buffer ...
-
bioRxiv - Biochemistry 2021Quote: FLAG-CAHS1 was constructed using standard genetic engineering techniques with an N-terminal FLAG using a pT7-FLAG-1 vector (Sigma-Aldrich, Merck). The bacterial cells of E ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were subsequently washed with PBS and incubated for 2 h with the proper secondary antibodies (1:300, goat anti-rabbit Alexa-Fluor® 647, AP187SA6, Merck Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were then incubated for 1 hour with a species-appropriate HRP-conjugated secondary antibody (diluted 1:5000 in TBST) before bands were visualised using Immobilon Forte Western HRP Substrate (Merck Millipore). Primary antibodies used were mouse anti-αSMA (Dako ...
-
bioRxiv - Cell Biology 2019Quote: ... Total β1-integrin was detected by immunoblotting the membrane again with clone N29 anti-β1-integrin antibody (Merck, MAB2252, 1:1000) and appropriate secondary antibody and analysis on the Odyssey (LI-COR ...
-
bioRxiv - Genomics 2019Quote: ... ChIP was performed on this chromatin extract using 1 µL of Anti-acetyl-Histone H4 (Lys16) Antibody (Merck Milipore, 07-329) or 0.5 µL of Histone H3 antibody mAb MABI 0301 (Active Motif ...
-
bioRxiv - Paleontology 2020Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Neuroscience 2021Quote: Immunohistochemical staining was performed on free-floating brain sections using the following primary antibodies: mouse anti-rat TH (1:4000, MAB318, Merck Millipore), rabbit anti-Girk2 (1:500 ...
-
bioRxiv - Immunology 2021Quote: ... blocked in 5% BSA for 30 min and incubated ON with mouse anti-GAD67 monoclonal antibody (1:6000, MAB5406, Merck Millipore) or 1 h with rabbit polyclonal anti-GAPDH antibody (1:3000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated overnight at 4°C in blocking solution containing one of the following primary antibodies: anti-GFAP (1:2000; Merck Millipore) and anti-Iba1 (1:500 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lipids were resuspended in a small volume of chloroform/methanol (2:1) and applied to a to HPTLC plate (Silica Gel 60, Merck, Germany) together with DOPC/cholesterol and NeuGc/NeuAc GM3 as standards ...
-
bioRxiv - Microbiology 2021Quote: ... Aliquots of 10 μL were spotted into reverse-phase TLC (RP-TLC) plates (silica gel 60, RP-18, F254s, 1 mm, Merck, Germany). The plates were developed in chambers pre-saturated for 10 min using acetone as a solvent system ...
-
bioRxiv - Biochemistry 2021Quote: ... with 0.1% (w/v) RapiGestTM SF surfactant (Waters, UK) and protease inhibitors (Roche cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail, Merck, UK).
-
bioRxiv - Biochemistry 2020Quote: ... epithelium suspension cell line expressing the EBNA-1 protein (female origin) was cultured in EX-CELL(r) 293 Serum-Free Medium (Merck, 14571C) containing 4 mM GlutaMAX supplement (TermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... fixed with a 4% PFA solution and stained for tyrosine hydroxylase (TH; rabbit anti-TH, 1:1000, Cat#: 657012, Merck Millipore) and neurobiotin (Streptavidin Alexa Fluor conjugate 647 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Microbiology 2022Quote: ... Membranes were placed in fresh buffer PBS-T-milk for 1h (or 1h30 when performing the LTAs western blot in parallel) with the polyclonal rabbit anti-PBP2B antibody (at 1:5000, lab. stock or available at Merck ABS2199), the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... and additional wells with 20% biotinylated PLL-g-PEG and FNIII(7-10) were supplemented with 1 µM staurosporine (Merck Millipore) to serve as a positive control for apoptosis ...
-
bioRxiv - Bioengineering 2022Quote: ... These oligonucleotides were used to create a phage library representing all oligopeptides using the T7Select 415-1 Cloning Kit (Merck Millipore). Immunoprecipitation of the library was performed in accordance with a previously published protocol (Harhala et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... yeast of cell line BY4741 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) was grown in 1 litre of YPD (yeast extract (Merck/Sigma-Aldrich cat. no. 70161), peptone (Merck/Sigma-Aldrich cat ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4°C with primary antibodies against AVP neurophysin II (NP-II; MERCK, MABN845, PS41; 1:200); OXT NP-I (PS38 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The pre-cleared lysates were then incubated overnight at 4°C with polyclonal rabbit anti-TipR antibodies (1:400 dilution) (Kirkpatrick and Viollier, 2014) or monoclonal rabbit anti-HA antibodies (1:250 dilution) (Clone 114-2C-7, Merck Millipore). ...
-
bioRxiv - Neuroscience 2022Quote: ... and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4, Merck KGaA, Germany) in 0.05 M sodium borate buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... slices were incubated for 24-48h at 4°C with mouse anti-Neurophysin I (1:2000, Merck Millipore, marker for Oxytocin), rabbit anti-vasopressin (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... pH 7.0) containing the cOmpleteTM EDTA-Free protease inhibitor at a 1 x concentration following manufactureŕs instructions (Merck Millipore, Darmstadt, Germany). The buffer volume was proportional to the cell density of the sample ...
-
bioRxiv - Immunology 2024Quote: ... U-937 cells were maintained in RPMI-1640 medium supplemented with 4.5 g/L glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1.0 mM sodium pyruvate (Sigma-Aldrich; Merck KGaA), 10% fetal bovine serum (Hyclone ...
-
bioRxiv - Microbiology 2023Quote: ... the tetracycline resistance gene from pACE2 (Geneva Biotech, Genève, CH) and the two MCSs from pACYCDuet™-1 (Novagen, Merck Millipore). Csx23 was inserted into MCS-1 of pRATDuet (NcoI/SalI ...
-
bioRxiv - Immunology 2023Quote: Bovine cytokines and chemokines secreted in the supernatant by cells were measured using the commercial multiplex immunoassay MILLIPLEX MAP Bovine Cytokine/Chemokine Panel 1 (Merck/Sigma). Therefore ...
-
bioRxiv - Microbiology 2023Quote: ... the solution was incubated at 30 °C for 90 min and then derivatized with 20 µl of N-methyl-N-trimethylsilyltrifluoroacetamide with 1% trimethylchlorosilane (Merck, USA) at 70 °C for 30 min54 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cell suspension was centrifuged for 3 min at 200 x g and pellets resuspended in 1% BSA in PBS by pipetting 4 times up and down and filtering through 40 μm Flowmi strainer (Merck, Germany). Apoptotic and duplet cells were removed by staining the cell suspension with propidium iodide (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... blocked with normal serum for 1 h at 22–24°C and incubated overnight at 4°C with rabbit polyclonal anti-Lubricin antibody (1:500, MABT401, MERCK, DEU). The sections were then washed three times with PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Retinae were incubated overnight on a rocker at 4 °C with appropriate combinations of the following antibodies: guinea pig anti-RBPMS (1:300, catalog no. ABN1376; Merck Millipore); goat anti-Brn3a (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: Sections were rinsed in 0.1 M PBS three times each for 10 min and then incubated with: i)1:1000 anti-NeuN (A-60; Merck Millipore), 1:300 anti-ΠIII-Tubulin (Tuj1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Retinae were incubated overnight on a rocker at 4 °C with appropriate combinations of the following antibodies: guinea pig anti-RBPMS (1:300, catalog no. ABN1376; Merck Millipore); goat anti-Brn3a (1:100 ...
-
Autoimmune inflammation triggers aberrant astrocytic calcium signaling to impair synaptic plasticitybioRxiv - Neuroscience 2023Quote: ... The purity of the cultures was be routinely assessed by examining the characteristic cell morphologies under phase-contrast microscopy and confirmed by immunostaining with mouse anti-GFAP (1:200; Merck, MAB3402) and mouse anti-S100β (1:400 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were pre-cleared at 4°C for 1 h on a rotating wheel using 30 µl Protein-S agarose beads (Merck Millipore) slurry ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then incubated for 1 hour at room temperature with the anti-NOTCH1 primary antibody (Merck Life Sciences, Cat #: SAB4200024) diluted at 1:350 in 1% BSA blocking solution ...
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were eluted at 460 g at 4 °C for 30 s and concentrated in a 1% GDN pre-equilibrated 30 kDa Amicon Ultra centrifugal filter (Merck Millipore). The concentrated eluate was spun through a Zeba Spin Desalting Column 40 kDa MWCO (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Washed DPI-treated VBNC Mtb cells were resuspended with fresh Dubos broth and the suspension was diluted to 1:10 with Dubos broth with 0.1% (w/v) BSA containing adenylyl cyclase inhibitor SQ22536 (Merck, Darmstadt, Germany) or protein kinase inhibitor H89 (Abcam ...
-
bioRxiv - Biochemistry 2023Quote: Hippocampal cells (5.104 cells/well) were treated with 10 and 30 μmol L-1 H2O2 solutions [from H2O2 stock solution 30% (Merck, Germany), into supplemented neurobasal medium] fresh made ...
-
bioRxiv - Immunology 2023Quote: ... and PBMCs (1 × 106 cells per well) were seeded in 96-well plates in RPMI supplemented with 1% PNS and 10% AB human serum (Merck, UK) and stimulated with SARS-CoV-2 specific peptides pools ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: An immunofluorescence assay was performed in cryosections of rd10 animals using the following antibodies: rabbit polyclonal cone arrestin (1/5000, Merck Millipore), mouse monoclonal rhodopsin (1/1000 ...