Labshake search
Citations for Merck :
4051 - 4100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: Approximately 1 × 107 cells were lysed in 200 μL lysis buffer [50mM Tris pH 8 (Merck, T6066), 150mM NaCl (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... Peak fractions containing SETDB1 Triple Tudor protein were pooled and concentrated to 2 mL in Amicon Ultra-15 concentrators 10,000 molecular weight cut-off (Merck Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... Peak fractions were analyzed for purity by SDS-PAGE and those containing pure protein were pooled and concentrated using Amicon Ultra-15 concentrators 10,000 molecular weight cut-off (Merck Millipore, Car-rigtwohill Co. Cork TRL). Concentrated proteins were aliquoted and stored at -80°C in sizing buffer.
-
bioRxiv - Molecular Biology 2023Quote: ... 22 µL sample was mixed with 25 µL 2x KAPA 2G robust HS Master Mix (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany), 1.5 µL 10 µM Index 1 primer and 1.5 µL 10 µM Index 2 primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hoechst 33342 dye (Merck, B2261) was co-applied during washing at a final concentration of 0.5 µg/mL for nuclear staining.
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293T-indE received in addition Doxycycline (Merck, D5207) to a final concentration of 2 µg/mL for induction.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-Flag antibody (MERCK, F7425-.2MG, 1:1000 dilution), horseradish peroxidase (HRP)-conjugated anti-rabbit secondary antibody (Cell signaling ...
-
bioRxiv - Molecular Biology 2023Quote: ... Antibodies used for immunoblotting were: α-FLAG M2 (1:500; Merck-Sigma, F3165), α-Matr3 (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Relative levels of pFlareG were calculated for each condition using GAPDH as a housekeeping gene and normalized relative to FLAG-PTBP2 protein levels immunoprecipitated checked by western blot using α-FLAG M2 antibody (1:500; Merck-Sigma, F3165) and IRDye 800RD (1:10000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary immunofluorescence was staining with α-SRRM2 (1:250; Merck-Sigma, HPA066181) and secondary with Alexa 568 α-rabbit (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were digested with DNase I (Merck-Sigma, DN25) for 15 min and inactivated ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were plated at desired density on Poly-D-lysine (Merck-Sigma, P7886)-coated plates (0.5 mg/ml Poly-L-lysine in borate buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and loaded in 4–12% NuPAGE Bis-Tris gel (Fisher, 10247002) for subsequent electrophoresis and transference to nitrocellulose membrane (Merck-Sigma, GE10600003). Precipitated RNA was analyzed by autoradiography and FLAG-PTBP protein levels were measured by western blot.
-
bioRxiv - Molecular Biology 2023Quote: ... lysates were clarified by centrifugation at 12000g and incubated 2h at 4°C with pre-equilibrated α-FLAG M2 affinity gel beads (Merck-Sigma, A2220). Beads were washed three times with lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cell suspension was centrifuged for 3 min at 200 x g and pellets resuspended in 1% BSA in PBS by pipetting 4 times up and down and filtering through 40 μm Flowmi strainer (Merck, Germany). Apoptotic and duplet cells were removed by staining the cell suspension with propidium iodide (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1mM EDTA (Merck, E9884), 5mM MgCl2 (Merck,PHR2486) ...
-
bioRxiv - Molecular Biology 2023Quote: Duolink™ In Situ Red Starter Kit Mouse/Rabbit (Merck, DUO92101-1KT) was used to detect protein-protein interactions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5mM MgCl2 (Merck,PHR2486), 0.5% NP40 (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 80μl of formaldehyde (15% w/v in PBS) (Merck, F8775) was added for 10 min to the cultures ...
-
bioRxiv - Molecular Biology 2023Quote: ... the sample buffer was exchanged to water in 3 kDa cutoff Amicon centrifugal filters (Merck). The samples were then concentrated to a final volume of 30 μl and subjected to mass analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... the liposomes were removed by running the sample through 100 kDa cutoff Amicon centrifugal filters (Merck). Finally ...
-
bioRxiv - Pathology 2023Quote: ... decalcified in 10% ethylenediaminetetraacetic acid (Merck, GER) solution for 60 days ...
-
bioRxiv - Pathology 2023Quote: ... blocked with normal serum for 1 h at 22–24°C and incubated overnight at 4°C with rabbit polyclonal anti-Lubricin antibody (1:500, MABT401, MERCK, DEU). The sections were then washed three times with PBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the supernatant was transferred to Amicon® Ultra-0.5 3 kDa filter columns (Merck Millipore) and centrifuged at 14,000 × rpm for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... solfataricus P2 cbp1 gene (SSO0454) was cloned into pET-21a(+) (Merck) vector and transformed into BL21 Star (DE3 ...
-
bioRxiv - Microbiology 2023Quote: ... solfataricus cren7 gene (SSO6901) was cloned into pRSF-1b (Merck) and transformed into Rosetta2 (DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... α-Tubulin (Merck, T5168, 1:1000), GAPDH (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by 10 min permeabilization with 0.1% TritonX-100 (Merck, X100-100ML) before blocking with 100μL blocking buffer from the kit for 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were dehydrated in ethanol before mounting on microscope slides with fluoroshield (Merck). the slides were imaged using an Apotome widefield microscope (Zeiss ...
-
bioRxiv - Neuroscience 2023Quote: ... were used for LC-MS analysis along with SeQuant ZIC-HILIC column (150 mm×2.1 mm, 3.5 μm, Merck Millipore, 150442) in the positive mode and SeQuant ZIC-pHILIC column (150 mm×2.1 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... in the positive mode and SeQuant ZIC-pHILIC column (150 mm×2.1 mm, 5 μm, Merck Millipore, 150460) in the negative mode ...
-
bioRxiv - Microbiology 2023Quote: ... were pre-prepared by washing 3 times in immunoprecipitation buffer then resuspended in 200μl immunoprecipitation buffer and coated with 2 μl FLAG M2 (Merck Millipore) or IgG (Merck Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... or IgG (Merck Millipore, 12–370) control antibody ...
-
bioRxiv - Neuroscience 2023Quote: Cultured Hippocampal neurons were stained for MAP2 (1:1000, AB5622 Merck Millipore) and Tau-1 (1:1000 MAB3420 ...
-
bioRxiv - Neuroscience 2023Quote: ... Neurons were plated (12-well plate) on glass coverslips coated with poly-L-lysin-hydrochloride (1 mg/ml, Merck). After 2h ...
-
bioRxiv - Neuroscience 2023Quote: ... After removal of TCEP via 10 kDa molecular weight cut-off (MWCO) Amicon spin filters (Merck, #UFC500324), the reduced nanobodies were coupled using 10-fold excess of maleimide-DBCO crosslinker (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Neuroscience 2023Quote: ... and stored in ethylene glycol (30% ethylene glycol (Merck, 324558), 30% Glycerol (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... c- Fos anti-rabbit (1:200, Merck, ABE457), Gephyrin anti-Mouse-IgG1 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Free-floating sections were washed in 0.25% Triton-X100 (Merck) in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Brain slices were cultured 16 to 24 hours in semi-dry conditions (Millicell inserts, Merck Millipore), in a humidified incubator at 37 °C in a 5% CO2 atmosphere in wells containing Neurobasal medium supplemented with 2% B27 (Thermofisher #17504044) ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with protease inhibitor cocktail set III (Cat No. 539134-1 set, 1:100, Merck Millipore, Rahway, NJ). The lysate was centrifuged at 16,000 g at 4 LJ for 10 minutes to remove insoluble samples ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were performed using a high-fidelity polymerase (KOD-Xtreme, Merck Millipore) according to manufacturer protocol ...
-
bioRxiv - Physiology 2023Quote: ... Mice were injected intravenously (i.v.) two consecutive days with 1 mg of biotin-X-NHS Ester (BXN) (Millipore, Merck) per mouse dissolved in 200 μl of saline buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... Retinae were incubated overnight on a rocker at 4 °C with appropriate combinations of the following antibodies: guinea pig anti-RBPMS (1:300, catalog no. ABN1376; Merck Millipore); goat anti-Brn3a (1:100 ...
-
bioRxiv - Microbiology 2023Quote: Seawater or groundwater (4-5 L) were filtered using a peristaltic pump onto polycarbonate membrane filters (0.1 or 0.2 µm, 47 mm, Merck, Israel) and stored at −20°C until extraction (n=1 per sample except in selected samples where n=4) ...
-
bioRxiv - Biophysics 2023Quote: ... Homogenization of proteins and single molecules were performed using 8 U/ml proteinase K (PK, #P4850 Sigma Aldrich now Merck) in digestion buffer (800 mM guanidine HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... Whole purified His-MBP-ApoE4M was concentrated to a final concentration of ∼ 8 mg/ml using Centrifugal Filter Units AmiconR Ultra-15 UltracelR-3K (Merck Millipore Ltd., Ireland). The crystallization was performed in Easy-Xtal 15-well crystallization plates by a hanging drop vapour diffusion ...
-
bioRxiv - Neuroscience 2023Quote: ... Non-adherent cell culture plates were prepared with poly(2-hydroxyethyl methacrylate) (poly-HEMA; P3932, Merck) coating ...