Labshake search
Citations for Merck :
351 - 400 of 6204 citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were fixed with 4% paraformaldehyde (Merck) for 10 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 250 U/mL benzonase (Merck, 70746-4)) on ice for 1 hour prior to centrifugation at 4°C (20kg ...
-
bioRxiv - Biophysics 2021Quote: ... 4 mM CaCl2 (Merck Life Science, Norway) and 25 μM fluorescein sodium salt (Merck Life Science ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.8×10-4 M adenine (Merck, A3159), 0.5 µg/ml hydrocortisone (Merck ...
-
bioRxiv - Pathology 2022Quote: ... fixed (4% paraformaldehyde; Merck, #1.04005.1000 in PBS)(24h ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100 nM 4-hydroxy-tamoxifen (OHT; Merck) was added to the medium 48 hours before treatment with IACS-010759 or other drugs ...
-
bioRxiv - Immunology 2020Quote: ... and Polybrene (4 μg/ml; Merck Millipore) in a total volume of 7 ml (2 ml of a 15-min-preincubated transfection mix in serum-free DMEM added to 5 ml of fresh full DMEM) ...
-
bioRxiv - Physiology 2021Quote: ... and fixed with 4% paraformaldehyde (Merck, 104004), prior to fluorescent quantitation.
-
bioRxiv - Cancer Biology 2020Quote: ... fixed in 4% paraformaldehyde (Merck, Darmstadt, Germany) and subjected to flow cytometric analysis on a BD FACS Canto II (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... MOWIOL 4-88 (Calbiochem, Merck-Millipore, UK) mounting media was used in combination with 1 μg·mL-1 DAPI in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... galactose-4-sulfate was purchased from Merck KGA (Germany).
-
bioRxiv - Neuroscience 2022Quote: ... followed by 4% paraformaldehyde (PFA) (1004005, Merck) (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μg/ml α-Glucosidase (Merck) and incubated at 37℃for 30 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed with 4% paraformaldehyde (Merck) for 10 min and permeabilized for 5 min at room temperature with 0.1% Triton X-100 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 4% paraformaldehyde (PFA) (1004005, Merck) (w/v ...
-
bioRxiv - Bioengineering 2023Quote: ... fixed with 4% para-formaldehyde (PFA, Merck) for 20 min at room temperature (RT ...
-
bioRxiv - Plant Biology 2023Quote: ... and α-amylase (4 U/ml, Merck) in 200 mM sodium acetate– acetic acid ...
-
bioRxiv - Neuroscience 2023Quote: ... and fixed with 4% paraformaldehyde (Merck Millipore) solution for 15 minutes at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by 4% paraformaldehyde (PFA) (1004005, Merck) (w/v ...
-
FUS controls muscle differentiation and structure through LLPS mediated recruitment of MEF2 and ETV5bioRxiv - Neuroscience 2024Quote: ... Myotube cultures were fixed in 4% (Merck) and 10% sucrose (Roth ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µL of Benzonase® Nuclease (Merck) was added ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were fixed in 4% glutaraldehyde (Merck) in 0.1M phosphate buffer (Merck ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 μM Ethidium homodimer (E1903, Merck) in 1x PBS ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Cell Biology 2020Quote: ... washed in PBS and incubated for 2 min in 2 mM H2O2 (Merck) at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... or 2-deoxy-glucose (2-DG; 500 μg/g) (25972, Merck Life Sciences) were injected IP at Day 0 ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Cancer Biology 2024Quote: Lipids were extracted from adherent cells grown to near-confluency in 6 well plates using the procedure described above with the addition of 20 nmol of methyl nonadecanoate (Merck Life Science) as an internal standard ...
-
bioRxiv - Neuroscience 2023Quote: ... Brains were stored for 24 h at 4°C in 4% PFA and then washed and stored in PBS containing 0.05% sodium-azide (Merck). Within a week of perfusion ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... pericarp sections were incubated for 2 h in a 5% (v/v) Normal Donkey serum (NDS; Merck) blocking solution in MTSB ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were labeled with 20 mM 5-chloro-2-deoxyuridine (CldU, Sigma-Aldrich by Merck, Darmstadt, Germany) for 20 min ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktail 2 (1:1000) (Merck Life Sciences U.K. Ltd). Cell debris was removed from lysates via centrifugation (275 × g ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 % (v/v) 2-mercaptoethanol) and 25 U/mL Benzonase (Merck #70746).
-
bioRxiv - Neuroscience 2021Quote: ... 350 µl of a 1:100 dilution of 2-Mercaptoethanol (Merck, 8057400250), 250 µl insulin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-oligodendrocyte transcription factor 2 (Olig2) (Merck-Millipore, 1:200), rabbit polyclonal anti-ionized calcium-binding adapter 1 (Iba-1 ...
-
bioRxiv - Pathology 2023Quote: ... 1 µl of 10x TCEP (Tris(2-carboxyethyl)phosphine hydrochloride (#C4706, Merck) was added to the lid and mixed carefully ...
-
Investigation of a Novel Mouse Model of Prader-Willi Syndrome with Invalidation of Necdin and Magel2bioRxiv - Systems Biology 2024Quote: ... mouse anti-neurophysin 2 clone PS38 (1:1000, Ref# MABN844, Merck Millipore), rabbit anti-GnRH (1:3,000 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Microbiology 2020Quote: ... 5×106 cells from treated and untreated conditions were centrifuged for 5 min at 4,500 g and the pellets were resuspended in 4% paraformaldehyde (PFA, Merck, Germany), and incubated for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...