Labshake search
Citations for Merck :
151 - 200 of 6204 citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 0.8 μg/ml of 4-hydroxytamoxifen (4-OHT, Merck) was added to the culture medium for 48 hours to induce Cre-mediated excision of the promoter and first exon within the Oct4floxalleles ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Neuroscience 2023Quote: ... The protein was concentrated with an Amicon Ultra-4 (Merck Millipore, MWCO 3 K) to a concentration of 726 µM ...
-
bioRxiv - Microbiology 2024Quote: ... LS-ARS2 overnight culture was inoculated (1% v/v) in MRS broth adjusted to pH 4 and pH 3 with HCl (1N, Merck), followed by incubation for 0 ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The beads were pre-bound with 4-5 micrograms of antibodies (H3K4me3 – Merck 07-473 ...
-
bioRxiv - Microbiology 2024Quote: ... AGBs (4 mm) and glass beads (4 mm, Merck, Germany) were inoculated with P ...
-
bioRxiv - Biophysics 2020Quote: Upon deposition the samples were washed 2 times 15 minutes with PBS prior to overnight fixation with 4% paraformaldehyde (PFA, Merck, Darmstadt, Germany). Washing steps and incubation took place under agitation at 4 °C unless stated otherwise ...
-
bioRxiv - Neuroscience 2023Quote: GNAO1+/G203R#2 cells at the stage of neuronal rosettes (30 day of differentiation) were fixed in 4% paraformaldehyde solution (Merck Life Sciences) for 15 min at room temperature and washed thrice with 1X PBS (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were washed in 1x PBS and subsequently mixed with 100 μL 4% SDS (Carl Roth GmbH, Karlsruhe, Germany) and 2% beta-Mercaptoethanol (Merck, Darmstadt, Germany) in PBS ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Bioengineering 2021Quote: ... 99%+, Figure S1(d)), and dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP, 42% solution in methanol) were obtained from Merck–Sigma Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... serial 10-fold dilutions were prepared from the viral stock and used to transduce mESCs in a 6-well plate (Mock plus 10-2 to 10-6) together with 8 ng/µl polybrene (Merck) in duplicates ...
-
bioRxiv - Genetics 2021Quote: ... 5 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−2 to 10−6) for transduction with 8 ng/µl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Cell Biology 2024Quote: RBC suspensions at 2-5% parasitaemia were stained using 5 µg/ml Hoechst (Merck # 94403) for 20 min at 37 °C protected from light to stain the DNA ...
-
bioRxiv - Neuroscience 2022Quote: ... 4% sucrose (Merck) in PBS for 20 minutes in room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Cell Biology 2021Quote: ... SV40 T Antigen (Ab-2) (Merck Millipore; DP02; 5 μg/ml). Secondary antibodies (all from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Treatment with 2 µM hydrogen peroxide for 5 min (H2O2; Merck) was used to induce DNA strand-breaks and oxidative damage ...
-
bioRxiv - Genetics 2022Quote: ... 90 μl 5 M NaCl and 2 μl Pellet Paint (Merck) was added to each sample ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... were electrophoresed on SDS polyacrylamide gels ( NuPAGE™ 4-12% Bis-Tris Protein Gels; InvitrogenTM) and transferred to PVDF membranes (Millipore; Merck). Membranes were blocked in 2.5% (w/v ...
-
bioRxiv - Neuroscience 2024Quote: ACS was prepared from astrocyte cultures with aNSPC medium and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243 to obtain a < 3 kDa and a > 3 kDa fraction ...
-
bioRxiv - Immunology 2021Quote: ... and washed by ultracentrifugation at 4°C using a 3 kDa filter (UFC900324, Merck-Millipore) to remove imidazole ...
-
bioRxiv - Developmental Biology 2024Quote: ... and left overnight at 4°C in blocking solution containing 3% Donkey Serum (D9663, Merck) and 0.03% Sodium Azide (40-2000-01 ...
-
bioRxiv - Biophysics 2024Quote: ... 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck KGaA (Darmstadt ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3T3-J2 fibroblasts were treated for 3 hours with 4 μg/mL mitomycin C (Merck) at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... EGTA-eluates were pooled and concentrated to a final concentration of ∼2 mg/ml using an Amicon Ultra-4 cellulose centrifugal filter unit (Merck Millipore, Cat# UFC810024).
-
bioRxiv - Cancer Biology 2021Quote: ... cultures were treated with 4 μM of the CDK4/6 inhibitor Palbociclib/PD-0332991 (Merck, PZ-0199) for 8 days ...
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... The medium was then collected and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243). Five distinct preparations of ACS <3kDa were prepared from five astrocytes cultures and were then sent to the Protein Analysis Facility of the University of Lausanne for Mass Spectrometry analysis.
-
bioRxiv - Molecular Biology 2023Quote: ... All samples were fixed 1:1 with 4% PFA (Merck, no. P6148) (final concentration 2% PFA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and loaded in 4–12% NuPAGE Bis-Tris gel (Fisher, 10247002) for subsequent electrophoresis and transference to nitrocellulose membrane (Merck-Sigma, GE10600003). Precipitated RNA was analyzed by autoradiography and FLAG-PTBP protein levels were measured by western blot.
-
bioRxiv - Neuroscience 2021Quote: ... Microtubule-Associated Protein 2 (MAP-2) (Merck Millipore Burlington ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% glucose + 2% D/L-lactate (Merck), or 2% D/L-lactate alone [31].
-
bioRxiv - Cell Biology 2020Quote: ... 1 % Triton-X and 1x BugBuster (Merck Millipore, #70584-4) were added to lyse the bacteria for 30 min at 4 °C with gentle rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM TCEP with 4% SYPRO Orange dye (Merck, #S5692) were filtered in SpinX tubes (Corning ...
-
bioRxiv - Neuroscience 2024Quote: ... xylene (2 x 5 min) and coverslipped using Entallan mounting medium (Merck). Samples were imaged using an Olympus BX51 microscope equipped with an Olympus DP27 digital camera (Olympus Microscope Solutions).
-
bioRxiv - Cancer Biology 2024Quote: ... 2 nM T3 supplement (3,3′,5-triiodo-l-thyronine sodium salt) (Merck), and 100 IU/mL penicillin and 100 µg/mL streptomycin (Merck ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2022Quote: ... The remaining sample was incubated o/n on a rotary shaker at 4 °C with 2 μg of the appropriate antibody (IgG, 12-370 Merck; pSTAT1, 7649 Cell Signaling). The next day 25 μl Dynabeads resuspended in CDB/c were added and incubated for at least 1 h at 4 °C on a rotary shaker ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Developmental Biology 2022Quote: ... IWP2 (4 µM; Merck), XAV-939 (10 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% sucrose (Merck, S0389) in D-PBS for 15 min and permeabilized with 0.05% saponin (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 µM aphidicolin (Merck) was used to reduce proliferation and viability of small numbers of non-neuronal cells (Loreto and Gilley ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4% PFA-fixed (Merck) and paraffin-embedded tissues were cut into 15 μm sections (IHC ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 g PFA (Merck) was dissolved in 80 ml PBS heated to 60 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-OHT (Merck, #H6278) was dissolved in ethanol at 1 mM and used at a final concentration of 0.5 μM in the culturing medium.
-
bioRxiv - Cell Biology 2023Quote: ... Germany)/ 4% paraformaldehyde (Merck, Germany) in 0.05 M cacodylate buffer pH 7.4) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Benzonase (Merck, 70746-4)-treated biotinylated protein samples suspended in 1 mL RIPA buffer were incubated overnight at 4 °C ...