Labshake search
Citations for Merck :
351 - 400 of 1252 citations for 3 Thiophen 3 yl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: The capped-RNA after nsp10-nsp16 reaction was digested using 3 U of Nuclease P1 (Merck) in 50 mM ammonium acetate buffer (pH 4.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE; Corden Pharma, Plankstadt Germany) and Cholesterol (Merck Millipore, Germany) by a thin-film method modified from previously described by Wui (Wui et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Cell Biology 2021Quote: ... and were passed through a polycarbonate membrane filter with a 3-µm pore size (Merck Millipore). The supernatants (lysates ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified proteins were were concentrated > 60 μM using Amicon Ultra centrifugal filters (Merck; MWCO 3 kDa), rebuffered to 50 mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... After binding beads were washed 3 times with binding buffer (PBS with protease inhibitor cocktail (Merck) and 1 mM Na3VO4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µL of each methanolic extract were spotted on a HPTLC Silica Gel 60 plate (Merck). The mobile phase was composed of 50 % chloroform ...
-
bioRxiv - Immunology 2021Quote: ... Enriched HSPC-pDCs were then primed for 1-3 days in RF10 (RPMI-1640 medium (Merck) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... for 10 min followed by 3 washes and incubation in media containing 100 μM thymidine (Merck). Before fixation ...
-
bioRxiv - Cell Biology 2021Quote: ... Acetylated histone 3 was detected using a polyclonal rabbit antibody (Merck, 06-599, 3260200, 1:500) and visualized using a donkey anti-rabbit Alexa Fluor 488 secondary antibody (Molecular Probes ...
-
bioRxiv - Immunology 2021Quote: ... Excess of chelator was removed by ultrafiltration (Amicon Ultra 0.5 ml, 3 kDa MWCO, Merck Millipore) using the same buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... excess cisplatin and thiourea was removed by centrifugal filtration (Merck, Amicon® Ultra 3 kDa filters) at 14,000 rcf for 10 minutes at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... Proteins were concentrated using a centrifugal filter unit (3 kDa MWCO, Merck Millipore; Cat. No. UFC900324) at 3500 rpm and 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... and the protein was concentrated in a centrifugal concentrator (Amicon MWCO 3 kDa: Merck, Darmstadt, Germany) and stored at −20 °C in dialysis buffer (150 mM NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 3-10 mL of liquid culture was filtered through 0.2 um Polycarbonate (PC) membrane filters (Merck Millipore Ltd ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Biophysics 2022Quote: ... The pure protein obtained was concentrated using a 3 kDa Amicon® Ultra Centrifugal Filter (Merck).
-
bioRxiv - Microbiology 2024Quote: ... The parasite solution was passed through a filter of 3 μm exclusion size (Merck-Millipore, TSTP04700) to remove host cell debris and collected in 15 ml conical tubes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM DTT) using Amicon Ultra-15 3 K or 30 K centrifugation units (Merck Millipore). The phase separation assay was performed in the presence or absence of 10% polyethylene glycol 8000 (PEG-8000 ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: Wild-type (WT/AB) embryos at 3 dpf were anaesthetised in 0.2 mg/ml MS222 (Merck) and mounted on 1.2 % w/v/ low-melting point agarose (Merck) ...
-
Decoupling cell size homeostasis in diatoms from the geometrical constraints of the silica cell-wallbioRxiv - Microbiology 2023Quote: ... After 3 washes with deionized water (Milli-Q® IQ 7003 Ultrapure Lab Water System, Merck), the cells were dehydrated by washing in a graded series of ethanol ...
-
bioRxiv - Immunology 2023Quote: ... Excess of chelator was removed by ultrafiltration (Amicon Ultra 0.5 ml, 3 kDa MWCO, Merck Millipore) using the same buffer conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were blocked with 3% freshly made bovine serum albumin (BSA)/PBS buffer (Sigma-Aldrich/Merck). The antibody mix containing the individually diluted metal-conjugated antibodies in 0.5% BSA/PBS was applied to the slides ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2023Quote: ... and the flow-through was concentrated using an Amicon Ultracentrifugal filter (3 kDa MWCO, Merck-Millipore) and further purified by gel filtration (HiLoad™ 16/600 Superdex™ 200 gp ...
-
bioRxiv - Immunology 2023Quote: ... Pepstatin A Methyl Ester (Pepstatin A, 516485) and MCC950 (256373-96-3) were purchased from Merck. Ultrapure™ DNase/RNase-Free Distilled Water (10977035 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng G-CASE and 3 mL PEI solution (1 mg/mL) (Merck KGaA, Darmstadt, Germany). 100 µL transfected cells were seeded per well onto 96-well plates (Brand ...
-
bioRxiv - Bioengineering 2024Quote: ... and the elution fractions were concentrated with Amicon Ultra centrifugal filter units (3 kDa, UFC800324, Merck) to a concentration of 0.24 mg/mL (3.6 µM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein mixtures were incubated with 40μl PBST washed Streptavidin agarose resin (50% slurry, 69203-3 Merck) and incubated for 2h at room temperature on a roller ...
-
bioRxiv - Bioengineering 2024Quote: ... We then dissolved 100 μmol of N-ethyl-N’-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Merck, E7750) in 1 mL of MES buffer and added it to the beaker ...
-
bioRxiv - Neuroscience 2024Quote: ... a group of approximately 50 flies in a training tube alternately received 3-octanol (3OCT; Merck) and 4-methylcyclohexanol (4MCH ...
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein mixture was concentrated using Amicon Ultra 3 kDa MW cut-off device (Merck Millipore) to ∼15 mg/ml and used to set up commercial crystallisation screens using the sitting drop vapour diffusion method at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by incubation with 200 µl of blocking solution [3% bovine serum albumin (BSA) (10735086001; Merck) in PBS-T at 37 °C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... The mixture of labelled bile acids ([2,2,4,4-d4] cholic acid and [2,2,4,4-d4] lithocholic acid) obtained from Merck KGaA was dissolved at a final concentration of 100 μM (for each ...
-
bioRxiv - Neuroscience 2024Quote: ... Fatty acids used were palmitic acid (W283215, Merck), stearic acid (10002390 ...
-
bioRxiv - Bioengineering 2024Quote: ... 4.7 μg/mL linoleic acid-oleic acid (Merck), 100 nM dexamethasone (Merck ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... oleic acid and linoleic acid were obtained from Merck, all of them with a purity higher than 97%.
-
bioRxiv - Developmental Biology 2020Quote: ... all other conditions: N=3) in the presene of 4µg/ml polybrene (cat. TR-1003-G, Merck) (Supplementary Figure 2) ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2020Quote: ... and proteins were eluted using 100 µl of 150 ng/µl 3× FLAG Peptide (F4799, Merck KGaA) or HA peptide (HY-P0239 ...
-
bioRxiv - Biochemistry 2022Quote: ... and concentrated to 13.7 mg·ml-1 (A280=23.36) using a centrifugal filter (Amicon Ultra-0.5, MWCO 3 kDa, Merck Millipore) prior to crystallization ...
-
bioRxiv - Neuroscience 2022Quote: ... animals were briefly anesthetized with isofluorane and 200nl of 3 nM clozapine-N-oxide (CNO, #C0832, Merck) was infused bilaterally via implanted cannulae in ACx using a Hamilton syringe (10 μl ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mM MgCl2) using Amicon Ultra-0.5 mL Centrifugal Filters (30 or 100 K MWCO, Merck Millipore). After re-measuring the concentrations by densitometry ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 % (w/v) Bovine serum albumin and 3 % (v/v) goat serum (Merck Life Science cat. G9023). Following blocking ...