Labshake search
Citations for Merck :
601 - 650 of 1252 citations for 3 Thiophen 3 yl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Molecular Biology 2023Quote: ... Preparative scale reactions were carried out in 3 mL Slide-A-Lyzer cassettes (10 kDa MWCO, Merck Millipore, Darmstadt, Germany) in combination with custom-made FM containers57 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... reagent (chlortrimethylsilane [Merck KGaA, Darmstadt, Germany]/1.1.1.3.3.3-Hexamethyldisilasane [Sigma Aldrich, Co., St. Louis, MO, U.S.A]/pyridine [Merck KGaA, Darmstadt, Germany], 9:3:1) in a GC vial for GC-MS-SIM non-cholesterol analysis ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Biophysics 2023Quote: ... The C378A or C406A variants of 15N-pm-β2AR-Cter were labeled on the remaining cysteine using 3-(2-Iodoacetamido)-proxyl (Merck). Paramagnetic samples were recorded with a recycling delay of 2 s ...
-
bioRxiv - Biophysics 2023Quote: ... The purified Nup98 was concentrated to a final concentration of 165 µM using 3-kDa MWCO centrifugal filters (Merck Millipore) in a solution of 2 M GdmCl ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Neuroscience 2023Quote: ... To avoid unspecific labelling the sections were first incubated for 2 × 10 minutes in a solution of PB with 3% hydrogen peroxide (Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Microbiology 2023Quote: ... Blood from the dissected abdomen was absorbed onto a 3 x 20 mm piece of a Whatman FTATM card (Merck) and placed in a 2 mL tube ...
-
bioRxiv - Immunology 2023Quote: Bone marrow supernatants (0.5 mL per sample) were concentrated with 3 kDa MWCO Amicon Ultra Centrifugal filter devices (Merck Millipore) up to a final volume of 30 μL ...
-
bioRxiv - Genomics 2023Quote: ... DNA was fragmented in a 2 mL low-bind round bottom Eppendorf tube using a sterile 3 mm borosilicate bead (Z143928-1EA Merck) by vortexing for 1 minute at maximum speed as described in [23] ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed once in ice-cold PBS and then detached with ice-cold PBS containing Sigma Phosphatase Inhibitor Cocktail 3 (539134, Merck), CoMPLETE Protease Inhibitor tablets (11873580001 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... Target cells were transduced with 0.5 mL of viral supernatant in 3 mL of total medium supplemented with 8 µg/mL polybrene (Merck Sigma). 2 to 4 days post transduction ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were concentrated to an A260ml−1 of 3 (100 nM) using an Amicon Ultra 0.5 ml spin column with a 100 kDa cutoff (Merck Millipore) to an OD260 absorbance of 5.0.
-
bioRxiv - Molecular Biology 2023Quote: ... and the peak fractions were pooled and concentrated using a 3 kDa molecular weight cut off (MWCO) spin concentrator (Merck). The concentration of the protein was measured via Bradford assay against a bovine serum albumin (BSA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purification of the labelled proteins was done by repeated filtration in a 3 kDa filter (Amicon Ultra-15 Centrifugal Filter Unit, Merck).
-
bioRxiv - Molecular Biology 2024Quote: ... cell pellets were resuspended in 500 μL Nuclear RNA lysis buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 1% BSA (Merck, #B9000S), 0.1% Tween (Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... we included anti-human PD-1 IgG4 S228P antibody (10μg/ml, 1B8/HuPD1B-3, Merck & Co., Inc., Rahway, NJ, USA). For TIM-3 blockade (αTIM-3) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then 500 μL Nuclear RNA wash buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 1% BSA (Merck, #B9000S), 0.1% Tween (Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were then washed in PBS and incubated in 0.2% Sudan black in 70% ethanol at room temperature for 3 minutes to minimize autofluorescence and mounted on glass slides (Menzel-Gläser) with FluorSave (Merck Millipore).
-
bioRxiv - Neuroscience 2024Quote: ... After washing 3 times for 10 minutes with PBS, slices were mounted on glass slides (J2800AMNZ, Epredia) with FluorSave (345789, Merck).
-
bioRxiv - Immunology 2024Quote: Human monocytes were plated at 2 × 105 cells/well in 96 well plates and cultured for 2-3 days in RPMI supplemented with 10% human serum (from human male AB plasma, Merck), 1 U/mL penicillin and 0.1 mg/mL streptomycin ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Microbiology 2024Quote: ... LS-ARS2 overnight culture was inoculated (1% v/v) in MRS broth adjusted to pH 4 and pH 3 with HCl (1N, Merck), followed by incubation for 0 ...
-
bioRxiv - Neuroscience 2024Quote: ... or (2) collected 3 days after transfection and enriched by filter device (Amicon Ultra-15 Centrifuge Filters, Merck, Cat#UFC910008). Viral pellets were resuspended in sterile PBS ...
-
bioRxiv - Physiology 2024Quote: ... followed by 7 days treatment with primary antibodies diluted 1:10,000 in 100 ml immunostaining buffer (3% horse serum, 10% CHAPS (Merck, 220201), 2% Triton X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Zn and Mn extraction from earthworm tissue was performed using Teflon vessels and 7 mL of reverse aqua regia (3:1 ratio of HCl:HNO3; Merck, Darmstadt) on hot plates in an open system ...
-
bioRxiv - Molecular Biology 2024Quote: ... the marine nanofibers were washed three times with 500 μL of ultrapure water using an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa cutoff) (Merck Millipore). The collected marine nanofibers were dropped onto a copper grid ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dried pellet was mixed with Lysis buffer (9M urea, 4 wt% CHAPS, 2% Pharmalyte carrier ampholyte pH 3-10, Merck) and left overnight at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Biochemistry 2024Quote: ... HPLC-grade trichloroacetic acid (TCA) and difluoroacetic acid (DFA) were purchased from Merck and Sigma-Aldrich (Munich ...
-
bioRxiv - Microbiology 2020Quote: ... were percussed until the amoebae detached and 1mL of the culture media was filtered through a 3 µm cellulose acetate membrane (Merck, Germany) to retain the A ...
-
bioRxiv - Genomics 2022Quote: ... in 3×250 ml bottles and resuspended in 100 ml prewarmed 30°C YPD supplemented with 50 ug/ml Pronase (Merck 10165921001), at which point the count-up for the time course was initiated ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins were transferred to 100 mM bicarbonate buffer (pH 8.2) by using Amicon® Ultra Centrifugal Filters (3 kDa MWCO, Merck, USA) and mixed with 1 ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were washed off the filter with an ice-cold freshly prepared mixture of methanol/ethanol/chloroform (1:3:1) (ethanol LiChroSolv©, Merck, Darmstadt ...
-
bioRxiv - Cell Biology 2021Quote: ... rinsed four times with MTSB and treated for one hour at RT with 10% dimethylsulfoxide + 3% Igepal CA-630 (Merck # I3021) dissolved in MTSB ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 105 Cas9 TNG MKOS MEFs were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... were combined and concentrated using an Amicon concentrator tube (30 kDa MWCO for the Nb- fused biosensors, 3 kDa MWCO for HER2-Nb) (Merck-Millipore). A final volume < 5 mL was loaded onto a SEC column (HiLoad 200pg ...
-
bioRxiv - Cell Biology 2022Quote: ... crescentus cultures were grown overnight at 30 °C in 3 ml of 2x PYE49 (Peptone, Merck, #82303; Yeast Extract, Merck, #Y1626) medium under mechanical agitation (200 rpm) ...
-
bioRxiv - Cell Biology 2022Quote: ... crescentus cultures were grown overnight at 30 °C in 3 ml of 2x PYE49 (Peptone, Merck, #82303; Yeast Extract, Merck, #Y1626) medium under mechanical agitation (200 rpm) ...
-
bioRxiv - Systems Biology 2022Quote: ... UK) previously coated with calf-skin collagen (15 μg/cm2 and fibronectin 3 μg/cm2; both Merck Life Science UK Ltd.). The permeability of hCMEC/D3 cell monolayers to 70 kDa FITC-dextran (2 mg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-DIV cultured human spinal motor neurons and C5-C7 ventral horns of adult animals 3 days after surgery were estimated using a Rac1/Cdc42 Activation Assay Kit (#17-441, Merck Millipore). Briefly ...
-
bioRxiv - Developmental Biology 2020Quote: ... membranes were washed 3 times with TBS-T and subjected to chemiluminescence detection with Immobilon Western Chemiluminescent HRP (Horseradish Peroxidase) Substrate (Merck Millipore) using a Gel-Doc XR+ System (BioRad) ...