Labshake search
Citations for Merck :
301 - 350 of 399 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... The MILLIPLEX®MAP Human Isotyping Magnetic Bead Panel-Isotyping Multiplex Assay (HGAMMAG-301K-06, Merck) was used to measure IgG1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mg/l hydrocortisone and 1 µg/l and human epidermal growth factor (hEGF) (both Merck). To determine EC sex ...
-
bioRxiv - Microbiology 2023Quote: ... and mouse anti-human TMPRSS2 (monoclonal, clone P5H9-A3, cat num: MABF2158, 1:500, MERCK, USA) for a minimum of 2 h at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... medium was further exchanged with FibroGRO™ Complete Media Kit for Culture of Human Fibroblasts (Merck), consisting of a fibroblasts-specific basal media supplemented with P/S (0.5%) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Human Caco-2 colorectal adenocarcinoma cells (1.7×105 cells/cm2) were cultured in DMEM medium (Merck) containing 10% FCS at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2023Quote: ... the chips were coated with fibronectin (Human Plasma Fibronectin Purified Protein, Merck, Schiphol-Rijk, The Netherlands) in sterile PBS (100 μg/mL ...
-
bioRxiv - Neuroscience 2024Quote: The inhibitory activity of novel compounds against human recombinant AChE (hAChE, E.C. 3.1.1.7, purchased from Merck) and human plasmatic butyrylcholinesterase (hBChE ...
-
bioRxiv - Neuroscience 2024Quote: Rodent as well as human brain slices were stained using the antibodies NeuN (MAB377, MilliporeSigma (Merck), 1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... The animals used in our experiments were genotyped for expression of the transgene by quantitative PCR (qPCR) using the KAPA Mouse genotyping kit (Merck, Cat# MGKITKB-KK7301), with primer sequence (5’-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... Human embryonic kidney (293T) cells were maintained in the Dulbecco’s Modified Eagle Medium (D6046, Merck, Darmstadt, Germany) supplemented with 10% fetal bovine serum (FB-1365 ...
-
bioRxiv - Bioengineering 2021Quote: The sEVs used to validate the platform were collected from a commercial human serum purchased from Merck Millipore (same lot in all preparations ...
-
bioRxiv - Neuroscience 2021Quote: ... Injections of 50 µl NGF at a concentration of 0.8 µM (NGF, human recombinant, Calbiochem, Merck, Germany) dissolved in phosphate buffer saline (PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... The concentrations of Aβ40 and Aβ42 were determined in brain lysates using the ELISA kits according to the manufacturer’s instructions (human Aβ40 and Aβ42 brain ELISA, Merck).
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were sub-cultured on days 4 and 8 of differentiation onto human fibronectin (Merck Millipore, #FC010) coated plates at a ratio of 1:4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 400 µl of solution of recombinant TnC (Supplementary Materials and Methods) or purified human TnC (Merck Millipore) (15 µg/ml in 0.01% PBS-Tween ...
-
bioRxiv - Cell Biology 2023Quote: ... fully mature Xenopus females were injected with 260 U of human chorionic gonadotropin (hCG; Merck, Ovitrelle 250G) into the dorsal lymph sac about 12-16 h before use and kept overnight at 18 °C ...
-
bioRxiv - Genomics 2022Quote: ... females and males were primed with 20 U and 10 U human chorionic gonadotropin (hCG, Pregnyl, Merck), respectively ...
-
bioRxiv - Immunology 2022Quote: ... Human peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll density gradient centrifugation (GE-171440-02, Merck), collected from the interphase ...
-
bioRxiv - Neuroscience 2022Quote: ... C3 and C1 were analyzed with HCMP2MAG-19K-02 Human Complement Magnetic Bead Panel 2 (Merck Millipore). Supernatants from non-stimulated CTL and L2-PD astrocytes cultured for 14 days were collected and stored at −80°C for long storage ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were treated with 10 ng/ml of the recombinant human TNFα protein (Merck-Millipore, Cat# GF023) and the outcome was assessed at RNA or protein levels.
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cell Biology 2024Quote: The EMD MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Pane A – Immunology Multiplex Assay (Merck Millipore) was employed to simultaneously analyze TNF-α ...
-
bioRxiv - Microbiology 2023Quote: ... purified DNA from both input and ChIP fractions was diluted 1:4 in water and 1 μL was used for qPCR using a SYBR® Green JumpStart™ Taq ReadyMix™ (CAT S4438, Merck, UK) and a BioRad CFX96 instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... RIPA and FA fractions was assessed using the Human Aβ1-42 enzyme-linked immunosorbent assay (ELISA) Kit (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: Primary human macrophages (pMФ) were isolated from the whole blood of healthy volunteers with Biocoll separating solution (Merck) according to the manufacturer’s protocol and seeded at a density of 2×106 cells per well in a 6-well plate ...
-
bioRxiv - Biochemistry 2020Quote: ... Human Rab8a 6-176aa (referred to as Rab8a)-encoding DNA was cloned into a pet51b(+) vector (Merck Millipore), resulting in a construct with a N-terminal Strep® II tag and enterokinase cleavage site and a C-terminal 10xHis tag ...
-
bioRxiv - Biochemistry 2020Quote: ... at increasing concentrations (3.8 pM–250 nM) in the presence of 90% heat-inactivated human serum (H5667, Merck) and incubated at 4 °C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... The human macrophage-like cell line U937 (ATCC no. CRL-1593.2) was cultured in RPMI-1640 medium (Merck) supplemented with 10% iFCS ...
-
bioRxiv - Cell Biology 2021Quote: Human hTERT RPE-1 cells (ATCC, CRL-4000) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM/F12, Merck) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Cell Biology 2023Quote: Glass bottom well plates (Celvis) were coated with 5 µg/ml of human plasma fibronectin purified protein (Merck) for one hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: Glass bottom well plates (Celvis) were coated with 5 µg/ml of human plasma fibronectin purified protein (Merck) for one hour at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... cover slips were incubated with the primary antibody (SV40 T antigen mouse-anti-human, Merck-Millipore, 1:50) overnight at 4 °C in a humidifier chamber ...
-
bioRxiv - Developmental Biology 2024Quote: ... spermatozoa were released into 500 μL of preincubated human tubal fluid medium (HTF: Millipore, Merck KGaA, Darmstadt, Germany) for 10 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured for 14 days in RPMI 1640 (ccpro) supplemented with 10 % heat-inactivated human serum (Merck), 10 ng/ml IL-7 ...
-
bioRxiv - Bioengineering 2022Quote: ... Human brain endothelial cell line (hCMEC/D3) and EndoGRO™ MV cell medium kit were purchased from Merck-Millipore (MA ...
-
bioRxiv - Genomics 2023Quote: Luminex assays were performed using the Milliplex Human Cytokine/Chemokine Magnetic Bead Panel (HCYTOMAG-60K-41, Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... spermatozoa from JF1/MsJ males were capacitated in Human Tubal Fluid medium (Merck Millipore, Cat#MR-070-D) supplemented with 10 mg ml−1 Albumin (Sigma ...
-
bioRxiv - Pathology 2024Quote: ... after a 2 hours fasting period followed by an intraperitoneal (i.p.) injection of human insulin (0.75 U.kg-1 of body weight; I9278, Merck, Germany), glycaemia was measured in the same way as for the OGTT.
-
bioRxiv - Microbiology 2020Quote: ... First strand cDNA preparations were diluted 1:10 with RNase-free water and subjected to RT-qPCR using SYBR Green JumpStart Taq ReadyMix (Merck Life Science UK Ltd., Gillingham, UK), with primers specified in Table S2 ...
-
bioRxiv - Physiology 2020Quote: ... Insulin concentration was determined using the MILLIPLEX® MAP Human Metabolic Hormone Magnetic Bead Panel (Merck KGaA, Darmstadt, Germany) according to the manufacturer s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... Purified human integrin α5β1 and anti-α5 (MAB1956Z) and anti-α5β1 (MAB1999) antibodies were from Merck (Kenilworth, NJ, USA). Volociximab was from Novus Biologicals (Littleton ...
-
bioRxiv - Cell Biology 2021Quote: The digoxigenin-labeled antisense probe targeting bases 32-500 of human GNRH1 mRNA (NM_001083111.2) was transcribed in the presence of digoxigenin-11-UTP (Merck Millipore) in a reaction mixture containing linearized cDNA template (1 µg) ...
-
bioRxiv - Biochemistry 2020Quote: ... was equilibrated with increasing concentrations of NAb (30 pM–1.0 µM) in the presence of 90% heat-inactivated human serum (H5667, Merck) at a temperature of 4 °C overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... was mixed with unlabeled SARS-CoV-2 spike S1 at increasing concentrations (100 pM–3.2 µM) in the presence of 90% heat-inactivated human serum (H5667, Merck) and incubated at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... CD3+ T cells were cultured in TexMACS Medium (Miltenyi Biotech) supplemented with 5% heat-inactivated human AB serum (Merck), 100 units/mL penicillin (Merck ...
-
bioRxiv - Cell Biology 2023Quote: 293T human embryo kidney (HEK293T) cells were grown in Dulbecco’s modified Eagle’s medium (4.5 g/l glucose) (Merck, Dorset, UK) enriched with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2024Quote: Plasma cytokine/chemokine levels were measured using the Human Th17 Magnetic Bead Panel (TH17MAG-14kMILLIPLEX MAP, Merck; Darmstadt, Germany) allowing the simultaneous quantification of the following cytokines ...
-
bioRxiv - Cell Biology 2024Quote: The CAF domain (residues 148-223) of human PMEL was subcloned into the pET24a plasmid (Merck Millipore, Darmstadt, Germany) and transformed into E ...
-
bioRxiv - Microbiology 2021Quote: ... PBMCs (2 × 106 cells) were plated onto 48-well plates (NalgeNunc) in RPMI-1640 with 5% inactivated male human AB serum (Merck) for 3 hours ...