Labshake search
Citations for Merck :
51 - 100 of 399 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... using primer sets (Merck Millipore) designed with the Primer Designing Tool from NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-alpha-smooth muscle actin (αSMA, clone 1A4, Merck, Cat Number: A2547), anti-Slug (clone C19G7 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubation with mouse anti-alpha-tubulin antibody [1:20.000 (T6074, Merck)] and proceeding with secondary antibody staining and detection as described above.
-
bioRxiv - Microbiology 2024Quote: ... PNPG (p-nitrophenyl-alpha-D-glucopyranoside) LOT: 3533550 was obtained from Merck Darmstadt ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-GABAA (mouse anti-GABAA receptor β2,3 chain, 1:100, Merck MAB341). To visualize specific binding of the primary antibodies ...
-
bioRxiv - Developmental Biology 2021Quote: ... blocking and incubation with mouse anti-alpha-Tubulin antibody (1:20.000 [T6074, Merck]) and proceeding with secondary antibody staining and detection as described above ...
-
bioRxiv - Physiology 2023Quote: ... a specific inhibitor targeting the alpha subunit of the Gi/o protein (Merck); U73122 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti-alpha sarcomeric actin clone 5C5 (#2172, Sigma-Aldrich, Merck Darmstadt, Germany) (1:500 v/v dilution in 5% BSA in PBS tween 0.05%) ...
-
bioRxiv - Bioengineering 2024Quote: ... The HBMSCs were expanded in minimum essential medium alpha (αMEM D4526; Merck, Germany) supplemented with 10 % fetal bovine serum (FBS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 1.8 ul of LD forward primer set pools (10 uM per primer, provided by MERCK) using 25 ul of Q5 Hot Start Master Mix (2X ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 1 ul of FR1 forward primer set pools (10 uM per primer, provided by MERCK) using 25 ul of Q5 Hot Start Master Mix (2X ...
-
bioRxiv - Systems Biology 2020Quote: FGF receptor inhibitor (FGFRi) stock: PD 173074 (#P2499-5MG, Merck & Co., Inc., NJ, USA) diluted in DMSO (#D2650-5×5ML ...
-
bioRxiv - Developmental Biology 2020Quote: ... final oocyte maturation was triggered with 250 µg of alpha-choriogonadotropin (Ovitrelle®, MERCK) or 0.3 mg of triptorelin (Decapeptyl® ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µl of Oligo-dT primer (Merck) and 5.7 µl of RT mix ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primers (Table EV1) were purchased from Merck Millipore ...
-
bioRxiv - Immunology 2023Quote: ... with the following Taqman Assays primers (Merck): Cyp1a1 (Mm00487218_m1) ...
-
bioRxiv - Cell Biology 2023Quote: ... All primers were purchased at 0.025µmol (Merck) and 1mM stock solutions prepared in TE (10 mM Tris ...
-
bioRxiv - Microbiology 2024Quote: ... PCR primers were purchased from Merck (Germany) and are listed in supplementary Table S2 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All primers used were purchased by Merck and are listed in the Supplementary Table 3 ...
-
bioRxiv - Biophysics 2021Quote: ... The reconstituted receptors were cleared by moderate centrifugation via spin filter microtubes (Merck Millipore Ltd.) followed by size exclusion chromatography using a Superdex 200 Increase 10/300 GL column (GE ...
-
bioRxiv - Molecular Biology 2022Quote: ... Glucocorticoid Receptor antibody (#3660, Cell Signalling Technology) or control IgG antibody (#03-198, Merck Millipore) and incubated for 1 h at room temperature whilst rotating ...
-
bioRxiv - Biophysics 2023Quote: The labeled and purified receptor was concentrated using a 30 kDa MWCO filter (Merck, Amicon Ultra) to 10–15 µM ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... PCR was performed with specific primer sets (Merck) directed against TRPV4 and β-actin (Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.4 µM of each primer (Merck (Sigma-Aldrich), Germany ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-phosphorylated (Ser897)-N-methyl-D-aspartate receptor (anti phosphoNMDAR cat.#ABN99, Merck Millipore, Burlington, MA, USA), anti-total-calcium/calmodulin-dependent protein kinase II (anti-tCaMK ...
-
bioRxiv - Neuroscience 2024Quote: ... NPY receptor antagonists (NPY1R: 10 µM BIBP 3226, Tocris 2707; NPY2R: 100 nM BIIE 0246, Merck SML2450) were added to brain slices 1 h before the start of recordings99,100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Commercially synthesized primers (Merck Life Science Srl, Milan, Italy) used in this work are listed in Table 1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... using pre-designed KiCqStart™ primers (H_MYC_1, H_GAPDH_1; Merck).
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.2 μM of each primer (Merck Life Science, desalted), less than 500 ng template DNA (1 μL genomic DNA at ~1-5 ng/μL) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The following predesigned KiCqStart SYBR® Green primers (Merck) were used ...
-
bioRxiv - Microbiology 2020Quote: ... Oligodeoxyribonucleotide primers (Supplementary Table S4) were obtained from Merck. Enzymes were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant DNA reagents and primers were purchased from Merck. As calibration samples in ALEX as well as anisotropy experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... US unless stated otherwise and primers were from Merck, India.
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... and specific KiCqStart® SYBR® Green primers (Merck). MicroAmp™ Optical 384-Well Reaction with 10µL reactions were loaded into a QuantStudio™ 5 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... and KiCqStart SYBR green primers (Sigma Merck, Table S1). Obtained Ct values were used for relative quantification of mRNA expression using the ddCt method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 µM forward and reverse primers (Merck KGaA, Germany), 0.02 U Phusion Hot Start II High-Fidelity DNA polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... the receptor-containing fractions were pooled and concentrated in a 50 kDa concentrator (Amicon Ultra, Merck MF-Millipore) to a concentration above 50 μM and subsequently diluted with D2O and SEC buffer to 50 μM with 10% D2O ...
-
bioRxiv - Microbiology 2023Quote: ... JKD6004 and the JKD6009/JKD6008 (VSSA/VISA) pair were routinely cultured at 37°C on solid or in liquid brain heart infusion (BHI, Merck) or Mueller-Hinton (MH ...
-
bioRxiv - Microbiology 2021Quote: ... Human HDL (Merck Millipore) was incubated with NS1 for 1 hour at 37°C prior to the DSC experiments ...
-
bioRxiv - Immunology 2021Quote: Native human insulin (Merck) was pre-diluted in water to 1 mg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... auris cells (CHRIST Alpha 1-2 LD plus lyophilizer, Osterode, Germany) using Tri Reagent (Merck Ltd. Budapest, Hungary). The quality of RNA was determined using the Eukaryotic Total RNA Nano kit (Agilent ...
-
bioRxiv - Biochemistry 2022Quote: Site directed mutagenesis was performed with custom designed primers (Merck) and PCR with Phusion High-Fidelity DNA polymerase (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fluorescently labeled primers and RNA oligomers were obtained from Merck.
-
bioRxiv - Microbiology 2021Quote: ... Aliquots of 2 ml of each recipient and donor strains were combined (three mating pairs in total) and filtered through sterile 0.22 µm membranes (Merck Millipore, GSWP02500), which were incubated over TSA plates for 8 days at 22°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... All qPCR reactions used FastStart Universal Probe Master (Merck) with the manufacturer’s recommended reaction conditions with some minor adjustments ...
-
bioRxiv - Neuroscience 2024Quote: qPCR RNA was isolated from FLS using TRIzol (Merck) and an RNA clean up and concentrator kit (Zymo Research) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5.06% fibrinogen (human plasma; Merck), 3U/mL thrombin (Stago BNL ...
-
bioRxiv - Microbiology 2022Quote: ... Plasma-purified human thrombin (Merck) was then added to reactions as required from a 1 IU / μL stock ...
-
bioRxiv - Biophysics 2024Quote: ... human epidermal growth factor (Merck), hydrocortisone (Merck) ...