Labshake search
Citations for Merck :
301 - 350 of 3260 citations for 6 methyl 4 oxo 5 6 dihydro 4H thieno 2 3 b thiopyran 2 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... L-glutamine (2 mM; Merck), β-mercaptoethanol (50 µM ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg/ml U18666A (Merck) or vehicle (DMSO only ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitor cocktail–2 (Merck) at 1% (v/v) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 CaCl2 (Merck KGaA) at pH 7.4 ...
-
bioRxiv - Neuroscience 2020Quote: ... WO-2 MABN10 (Merck Millipore). Membranes were washed ...
-
bioRxiv - Cell Biology 2021Quote: ... Dithiothreitol (DTT; 2 mM; Merck). The lysate was cleared by centrifugation (18 000 g for 8 min at 4 °C) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µl Benzonase (Merck-Millipore) and sonicated for 45 min (intervals ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mM CaCl2 (A862982, Merck), 1 mM MgCl2 ...
-
bioRxiv - Immunology 2023Quote: ... and 2 units thrombin (Merck)/mg SCT protein previously measured by mouse-IgG-Fc-based sandwich ELISA following an overnight incubation at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 mM EDTA (Merck). Isolated cells were passed through a 70 μm cell strainer (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2023Quote: ... 2 mM MgCl2 (1.05833.0250, Merck), 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 2 mM L-glutamine (Merck), 5 μg/ml human insulin (Merck) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM CaCl2 (Merck; 1023780500), 1 mM MgCl2 (Merck ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 µM ubiquinone-2 (Merck) and 0.01-0.05 µM RC-LH1 in a buffer mixture containing 50 mM Tris ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Physiology 2020Quote: ... and embedded in methyl methacrylate (MMA; Merck). The received block was additionally referenced for further control with the milling of three opposing grooves.
-
bioRxiv - Cell Biology 2022Quote: ... medium was replaced with the culture medium containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Cell Biology 2020Quote: ... and Click-iT® EdU (5-ethynyl-2’deoxyuridine) Assay (BCK-EDU488, baseclick GmbH, Merck/Sigma-Aldrich, UK), respectively ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Molecular Biology 2024Quote: ... The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck), respectively ...
-
bioRxiv - Biochemistry 2022Quote: ... and sodium chloride were bought from Merck. Antibiotics (ampicillin and chloramphenicol ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5% TTC (2,3,5-triphenyl tetrazolium chloride, Merck) aqueous solution was applied to indicate the lowest doses of concentration in which the microorganisms grew as the boundary dilution without color change.31 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Selection for single clones was performed using 2 µg/µl puromycin (Merck; 58-58-2) for PaTu8988t cells and 0.3 µg/µl for BxPC3 cells ...
-
bioRxiv - Microbiology 2024Quote: ... Primary CD4+ T-cells were activated with 100U/μl of interleukin-2 (IL-2; Merck) and phytohemagglutinin-L (PHA-L ...
-
bioRxiv - Developmental Biology 2023Quote: ... All the oocytes harvested from COCs were transferred to activation medium composed of KSOM medium supplemented with 5 mM strontium chloride (13909, Merck) and 2 mM EGTA (A0878 ...
-
bioRxiv - Biochemistry 2023Quote: ... was performed on 4 and 2.5 mg protein lysates for timsTOF optimization and dual-probe analyses respectively in 2 M urea (Merck) in 1× 50 mM HEPES (pH 7.5) ...
-
bioRxiv - Microbiology 2023Quote: ... 100 ml of the cell suspension at an OD660 of 0.6 was harvested by centrifugation at 5,000×g for 10 min at 4°C and resuspended in 2 ml of BugBuster (Merck), and 50 μg/ml lysozyme and 1 mM phenylmethanesulfonyl fluoride (PMSF ...
-
bioRxiv - Immunology 2021Quote: ... was mixed 1:1 and incubated at RT for 2-3 min or ECL substrate is added (Immobilon crescendo western HRP substrate, WBLUR0100, Merck). Membranes were then exposed to film and developed or visualised by chemiluminescence using the G:BOX Chemi gel doc Imaging System Instrument (Syngene) ...
-
bioRxiv - Neuroscience 2021Quote: Viability of SH-SY5Y cells after treatments with or without H-LIPEF was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Biochemistry 2022Quote: ... The purified proteins were concentrated to 2 mg/mL using centrifugal filters with either 3 kDa or 30 kDa cut-off (Amicon Ultra-0.5, Merck/Millipore) and the samples were centrifuged at 100,000 g ...
-
bioRxiv - Genetics 2021Quote: ... At day 10 cells were passaged at a 2:3 ratio into 12 well cell culture plates coated with 15 µg/ml human plasma fibronectin (Merck) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Microbiology 2023Quote: ... were pre-prepared by washing 3 times in immunoprecipitation buffer then resuspended in 200μl immunoprecipitation buffer and coated with 2 μl FLAG M2 (Merck Millipore) or IgG (Merck Millipore ...
-
bioRxiv - Pathology 2023Quote: ... To prevent unspecific labelling the sections were incubated for 2 × 10 minutes in PB solution containing 3% hydrogen peroxide (Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Biophysics 2023Quote: ... The C378A or C406A variants of 15N-pm-β2AR-Cter were labeled on the remaining cysteine using 3-(2-Iodoacetamido)-proxyl (Merck). Paramagnetic samples were recorded with a recycling delay of 2 s ...
-
bioRxiv - Neuroscience 2023Quote: ... To avoid unspecific labelling the sections were first incubated for 2 × 10 minutes in a solution of PB with 3% hydrogen peroxide (Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Genomics 2023Quote: ... DNA was fragmented in a 2 mL low-bind round bottom Eppendorf tube using a sterile 3 mm borosilicate bead (Z143928-1EA Merck) by vortexing for 1 minute at maximum speed as described in [23] ...
-
bioRxiv - Neuroscience 2024Quote: ... animals at the age of 3 months were perfused using 2% Formaldehyde (Science Services, München, Germany) and 2.5% Glutaraldehyde (Merck, Darmstadt, Germany) in 0.1M Cacodylate buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the beads were washed 3 more times with 100 µL lysis buffer 2 supplemented with 100 µg/mL polyU RNA (Merck). The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck) ...
-
bioRxiv - Immunology 2024Quote: The viabilities of the PBMCs or U-937 macrophages were analyzed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells seeded in 6-well plates or 100mm dishes were transfected using GeneJuice (Merck) and 1 to 3µg DNA ...
-
bioRxiv - Plant Biology 2019Quote: ... leaf samples were harvested with a 6-mm-diameter cork borer (Z165220; Merck-Sigma-Aldrich), resulting in leaf discs with an area of 0.283 cm² ...
-
bioRxiv - Physiology 2022Quote: ... Food contained low melting agar (OmniPur® Agarose, Low Melting, CAS 9012-36-6, Merck) during lifespan assessments only to ensure the quality of compounds was preserved ...
-
bioRxiv - Microbiology 2022Quote: ... The sample was then injected into a Superose® 6 Increase 10/300 GL (Merck) column ...
-
bioRxiv - Neuroscience 2022Quote: ... Agarose 0.6% brain phantoms50 were prepared by dissolving agarose (A9539, CAS 9012-36-6, Merck) in tris-borate-EDTA buffer 1X (T4415 ...
-
bioRxiv - Biophysics 2024Quote: ... The coated coverslips were rinsed twice with ethanol before incubation in 6% acetic acid (Merck) for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Cell Biology 2020Quote: ... at a final concentration of 5 μg/ml or Latrunculin B (428020-1MG, Merck) at a final concentration of 5 μM in M2 medium supplemented with dbcAMP ...