Labshake search
Citations for Merck :
251 - 300 of 3260 citations for 6 methyl 4 oxo 5 6 dihydro 4H thieno 2 3 b thiopyran 2 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-acetylated α-tubulin (clone 6-11B-1, Merck; ExM, 1:250), mouse anti-acetylated α-tubulin (T7451 ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Cell Biology 2020Quote: ... washed in PBS and incubated for 2 min in 2 mM H2O2 (Merck) at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Cell Biology 2023Quote: ... or 2-deoxy-glucose (2-DG; 500 μg/g) (25972, Merck Life Sciences) were injected IP at Day 0 ...
-
bioRxiv - Biochemistry 2019Quote: ... Sodium chloride was purchased from Merck. Additional reagents and consumable are mentioned below.
-
bioRxiv - Cell Biology 2020Quote: Cobalt Chloride (CoCl2, Merck, Darmstadt, Germany).
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... sodium chloride (#1064041000, Merck, Darmstadt, Germany), ViaFect™ Transfection Reagent (#E4981 ...
-
bioRxiv - Microbiology 2022Quote: ... iron (III) chloride hexahydrate (Merck, USA), citric acid (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... Potassium Chloride (KCl, 50 mM; Merck), (RS)-3,5-Dihydroxyphenylglycine (DHPG ...
-
bioRxiv - Neuroscience 2020Quote: ... Potassium chloride (Merck, 7447-40-7), Sodium chloride (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: Ammonium chloride (NH4Cl) (Merck, Darmstadt, Germany) was diluted to a 1M stock concentration in H2O ...
-
bioRxiv - Developmental Biology 2021Quote: DPI (Diphenyleneiodonium chloride, Merck, Taufkirchen, Germany) treatment of 3 dpf zebrafish larvae before finfold resection was carried out as previously described (Robertson et al. ...
-
bioRxiv - Immunology 2020Quote: ... 100 mM Sodium chloride (Merck, Germany), pH 6.6 as mobile phase ...
-
bioRxiv - Developmental Biology 2022Quote: ... or Manganese Chloride (Sigma Merck, 2mM) was added to proliferating myoblasts for 24 hours or 3 hours respectively ...
-
bioRxiv - Microbiology 2022Quote: ... To each tube 1 μL of Tris((1-benzyl-4-triazolyl)methyl)amine (TBTA) solution (2.5 mM in DMSO; Merck), 10 μL of Tetrakis(acetonitrile)copper(I ...
-
bioRxiv - Bioengineering 2021Quote: ... 99%+, Figure S1(d)), and dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP, 42% solution in methanol) were obtained from Merck–Sigma Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... pericarp sections were incubated for 2 h in a 5% (v/v) Normal Donkey serum (NDS; Merck) blocking solution in MTSB ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Biochemistry 2023Quote: ... 400 μg of AtLEGβ or papain were inhibited with 0.5 mM or 5 mM S-methyl methanethiosulfonate (MMTS, Merck), respectively ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM 2-mercaptoethanol) supplemented with a protease inhibitor cocktail (cOmplete, Sigma-Aldrich/Merck). Cell extracts were injected into a Ni Sepharose column for affinity chromatography purification followed by size exclusion chromatography of the RnlA-mutant–containing fractions as a final step ...
-
bioRxiv - Immunology 2020Quote: 2-5.105 cells were incubated for 2 h with different concentrations of H2O2 (Merck) or for 2 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml/well of overlay [MEM containing 2% FBS and 0.4% tragacanth (Merck, Israel)] was added to each well and plates were incubated at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... Na2HPO4· 7H2O (Sodium phosphate dibasic heptahydrate, M=268g/mol, CAS 7782-85-6, Merck), NaH2PO4 · H2O (Sodium phosphate monobasic monohydrate M = 138g/mol ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6), anti-GFAP (goat polyclonal ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... All routine cultures were performed in 6-well plates (Greiner, 657160, Merck, Darmstadt, Germany) at 37°C in 5% CO2 ...
-
bioRxiv - Biochemistry 2021Quote: ... concentrated to 6 mg/ml by a 100-kDa cut-off Centricon (Merck Millipore), and flash frozen for further cryo-EM grid preparation.
-
bioRxiv - Microbiology 2022Quote: ... The sample was loaded onto a Superose® 6 Increase 10/300 GL (Merck) column ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.3 U hexokinase (Scientific Laboratory Supplies) and 1 U glucose-6-phosphase dehydrogenase (Merck) in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6) or 1:200 anti-oxytocin receptor (polyclonal rabbit ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x phosphatase inhibitor 2 (Merck) and 1x phosphatase inhibitor 3 (Merck) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli Rosetta 2 cells (Merck) by induction with 0.2 mM isopropyl β-d-1-thiogalactopyranoside for 18 h at 18 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... coli Rosetta 2 (DE3) (Merck) and purified using Glutathione Sepharose High Performance beads (GE Healthacare ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 mM glutamine (Sigma, Merck) and 1% penicillin-streptomycin (Pen-Strep ...