Labshake search
Citations for Merck :
301 - 350 of 5445 citations for 1 3 Bis S 1 naphthalen 1 yl ethyl 4 5 dihydro 1H imidazol 3 ium tetrafluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (Merck; UK 28718-90-3) was included as a final wash stage ...
-
bioRxiv - Physiology 2024Quote: ... - 3% horse serum (Merck, ref H1270) PBS solution for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h ...
-
bioRxiv - Developmental Biology 2024Quote: ... or 3% Rabbit Serum (R9133, Merck)) and finally applying the conjugated antibody ...
-
bioRxiv - Cell Biology 2022Quote: ... blots were blocked for 1 h and incubated overnight at 4 °C with anti-Amyloid fibrils (OC, 1:5000, Merck-Millipore), anti-prefibrillar oligomers (A11 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were centrifuged for 5 min at 20 000 x g and supernatants were immunoprecipitated for 1 h rotating at 4°C with mouse anti-GFP antibody (1 µg antibody per sample, 11814460001 Merck/Sigma) and 20 µl DynabeadsTM Protein G (10004D ...
-
bioRxiv - Synthetic Biology 2024Quote: ... IL) for 10 minutes, followed by base piranha cleaning (1:1:4 H2O2 (000855032300, Bio-Lab, IL):NH3 (105432, Merck, DE):H2O ...
-
bioRxiv - Developmental Biology 2024Quote: ... at room temperature for 1 hour and incubated with primary antibodies (KLF4, 1:500, Proteintech, 11880-1-AP; KLF5, 1:500, Proteintech, 21017-1-AP; SOX9, 1:600, Merck, AB5535 ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Molecular Biology 2023Quote: ... separated using mPAGE 4-12% Bis-Tris precast gels (Merck Millipore, MP81G15) in mPAGE MOPS SDS Running Buffer (Merck Millipore ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound proteins were analysed by mPAGETM 4-20% Bis-Tris gels (Merck) and Coomassie staining ...
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Biophysics 2024Quote: ... The 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck (Darmstadt, Germany). Cholesterol (Chol ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked in 5% skim milk in TBS for 1 hour and probed with mouse γ/9d 2G10.2 (1:1000, MERCK MABT1335), rabbit anti mouse IgG (1:3000 ...
-
bioRxiv - Immunology 2021Quote: ... 1 μM Src inhibitor-1 (Merck), 2.5 μM Src inhibitor PP1 (Cayman Chemical ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µM Ferrostatin-1 (Merck, #SML0583), 10 µM oleic acid (Merck ...
-
bioRxiv - Microbiology 2023Quote: ... 1 g.L-1 L-cysteine (Merck) and 1 g.L-1 NaHCO3 (Carl Roth GmbH ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 nM 3,3′,5-Triiodo-L-thyronine sodium salt (Merck, cat. #T6397), and 1% penicillin-streptomycin (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... A solution of 5 g·L-1 bovine serum albumin (Merck-Sigma A9647) was used to construct a standard curve ...
-
bioRxiv - Biochemistry 2021Quote: ... The cells were fixed for 1 h at room temperature with 4% buffered formalin solution containing 1% crystal violet (Merck, Darmstadt, Germany). Finally ...
-
bioRxiv - Neuroscience 2021Quote: Ethyl alcohol was purchased from Merck Chemicals (Darmstadt ...
-
bioRxiv - Neuroscience 2023Quote: Ethyl alcohol (Merck Chemicals, Darmstadt, Germany) was diluted in tap water to obtain a 20% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-HES-1 (1:500, 1% casein, #AB5702, Millipore, Merck, Darmstadt, Germany), anti-LRP6 (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked again and incubated overnight at 4°C with DAPI (1:2000) (Merck) and anti-rabbit AlexaFluor-488 (1:500 ...
-
bioRxiv - Genetics 2024Quote: ... The LC separation was performed using the SeQuant Zic-pHilic (150 mm 3 2.1 mm) with the SeQuant guard column (20 mm 3 2.1 mm) (Merck). Mobile Phase B was acetonitrile ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Microbiology 2024Quote: ... and 3% Normal Goat Serum (Merck, S26)) for 1h at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mg/ml collagenase P (Merck), 1 mg/ml collagenase B (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3% Normal donkey serum (NDS, Merck), 2%BSA (NACALAI TESQUE) ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated o/n at 4°C with the primary antibodies (Rabbit-antiGFAP: MAB3402, Merck Millipore, 1:500; Mouse-antiNeuN: MAB377, Merck Millipore, 1:500) diluted in the blocking solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% glutamine and 1% penicillin/streptomycin (Merck). Fascin KD cells were selected and maintained using puromycin ...
-
bioRxiv - Neuroscience 2020Quote: ... GluA1 (1:250-1:500; Merck Millipore) and RTP801 (1:100 ...
-
bioRxiv - Biophysics 2024Quote: ... 1 µL of 1:1000 fluorescein (Merck) was added to a well and incubated for 10 mins before observation ...
-
bioRxiv - Neuroscience 2024Quote: ... 1-methyl-D-tryptophan (1-DMT; 1-LMT enantiomer, both Merck Life Sciences) for exploration of a possible tryptophan mechanism of immunosuppression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Methanol extracts were diluted 1:5 in Milli-Q water (Merck, Darmstadt, Germany) and subjected to reversed phase HPLC-MS using an Accela 1250 HPLC system equipped with a Hypersil Gold aQ column and coupled to a QExactiveTM mass spectrometer (all from Thermo Fisher Scientific ...