Labshake search
Citations for Merck :
251 - 300 of 5445 citations for 1 3 Bis S 1 naphthalen 1 yl ethyl 4 5 dihydro 1H imidazol 3 ium tetrafluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and 3% H2O2 (Merck, 216763). Fresh bleaching solutions were prepared and slides were bleached two times (15 min each ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM Chiron (Merck #SML1046), 1 μM PD 0325901 (Merck #PZ0162) ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 kDa MWCO (Merck - UFC500324) and 0.5 µl were injected to LC-MS system ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM MgCl2 (#105833, Merck), 2 mM EGTA (Triplex®VI #108435 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3% H2O2 (Merck – 216763). Fresh bleaching solutions were prepared ...
-
bioRxiv - Immunology 2023Quote: ... BAM-15 (3 μM; Merck), rotenone (2 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM ATP (Merck, A2383), 2 mM GTP (Jena Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... and 3% H2O2 (Merck, #216763,) for 3 rounds (15 mins each ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 mM MgCl2 (Merck, #7791186), 0.3% (vol/vol ...
-
bioRxiv - Bioengineering 2022Quote: ... The space between the tip wall and the tubing was filled with 20 μL HFE-7500 containing 0.1% 008-Fluorosurfactant (RAN Biotechnologies) and 35% 1-bromo-3,5-bis(trifluoromethyl)benzene (Merck). Each PTFE tubing was threaded four times through the fluidic connector and fused to wider PE tubing (0.38 mm ID ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mixture (2:1 v/v) of (PFA 4% (Merck, 104005) in PBS 1X pH7.4):OCT (Leica Surgipath ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti-pan- histone H11-4 (1:500; Merck, Cat#MAB3422) or chicken anti-GFP (1:500 ...
-
bioRxiv - Pathology 2023Quote: ... 1:1000 4-repeat tau (aa 275-291, 05-804, Merck); 1:500 3-repeat tau (aa 267-316 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Merck), mounted (Aqua Poly/Mount ...
-
bioRxiv - Cancer Biology 2024Quote: ... DSB were induced with 4-nitroquinoline 1-oxide (4NQO) (Sigma/Merck).
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed 3 times in TBS before being probed with protein A-peroxidase (Merck, 1:50000 in 10% Skimmed Milk in TBS). The membrane was incubated with 1x LumiGLO® / 1x Peroxidase (CellSignal ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Cell Biology 2021Quote: The vessel lumen was washed 3 times with PBS ++ (PBS with 1mM CaCl2, 0.5mM MgCl2) and fixed with 4% paraformaldehyde (PFA, Merck, #30525-89-4) at 37°C for 15 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... the sample were incubated in ethyl cinnamate for 4 hours at room temperature (112372-100G, Merck).
-
bioRxiv - Molecular Biology 2021Quote: ... The blots were incubated with primary antibodies to the following proteins overnight at 4 °C: (1) CTCF (1:1,000; 07-729, Merck Millipore), (2 ...
-
bioRxiv - Bioengineering 2022Quote: ... gels were washed for around 2-4 h with PBS and incubated in 1 ml 1 μM Alexa Fluor 546 NHS ester (NHS-AF546, #A20002, Merck), overnight at room temperature on a slowly rotating shaker ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mL of culture was sonicated for 3 s and 200 μL were loaded into a CellASIC® ONIX2 Y04C microfluidic plate (Merck Millipore) connected to the CellASIC® microfluidic pump (Merck Millipore) ...
-
bioRxiv - Developmental Biology 2020Quote: ... pH 7.4 (Carl Roth),125 mM KCl (Merck),1 mM MgCl2 (Merck),1 mM EGTA/KOH pH 8.0 (Carl Roth),5% glycerol (Merck),1% NP-40 (Nonidet P 40 Substitute ...
-
bioRxiv - Genomics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Genetics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked for 1 h with 5% skim milk (Merck) in TBST [50 mM Tris-HCL ...
-
bioRxiv - Molecular Biology 2024Quote: ... and anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were blocked for 1 hour with 5% BSA (Merck, #A3294) in T-BST at room temperature and incubated with primary antibodies (ETV6::RUNX1 ...
-
bioRxiv - Microbiology 2022Quote: ... α: β: γ: δ = 1:1:1:1 was obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were blocked 1h in 10% donkey serum in PBST and incubated overnight with primary antibodies for anti-GFAP (1:250, Merck Life Science, Hpa056030) and anti-MAP2 (1:200 ...
-
bioRxiv - Plant Biology 2021Quote: Arabidopsis 14-3-3 isoforms Epsilon and Lambda were expressed using the pGEX-4T1 vector (Merck), as a translational fusion with glutathione-S-transferase (GST ...
-
bioRxiv - Biophysics 2022Quote: HEK293T cells were cultured in 10 cm tissue culture treated dishes grown at 37 °C in a 5% CO2 atmosphere in HEPES buffered DMEM/F12 1:1 (Merck) supplemented with 10% fetal bovine serum and 2 mM L-glutamine ...
-
bioRxiv - Immunology 2023Quote: ... peptides were dissolved at a concentration of 1 to 5 mg ml-1 in 1x PBS and incubated with TCEP agarose CL4-B (Merck) for 1 hour to reduce paired cysteines ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were then incubated for 5 min in a 1:1 mixture of propylene oxide (Sigma-Aldrich, Merck, Darmstadt, Germany) and absolute ethanol ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Microbiology 2023Quote: ... slick SSW and non-slick SSW from sites #1 – #3 (Fig. 1b) were fixed with 25 % glutardialdehyde (0.5 % final concentration, Sigma-Aldrich/Merck Life Science AB, Solna, Sweden) and stored at −80 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM EGTA) and fixated for 20 min with 4% paraformaldehyde (Merck). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1x phosphatase inhibitor 3 (Merck). Cell debris was removed by pelleting at 5000g for 10mins ...
-
bioRxiv - Immunology 2021Quote: ... 3-Methyladenine (3MA, 5mM; Merck Millipore) or Anakinra (500ng/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-mGluR2/3 (Merck Millipore), rabbit anti-CRTAC1 (Merck Millipore) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3% bovine serum albumin (Merck). The azide-alkyne reaction was performed using the Click-iT™ Cell Reaction Buffer Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... nystatin (3 units/ml) (Merck: N1638) and ascorbic acid (500 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 units/ ml nystatin (Merck: N1638) and 20 mM HEPES ...