Labshake search
Citations for Merck :
3301 - 3350 of 3567 citations for Rat H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... immunofluorescence staining was performed using overnight incubation with polyclonal anti-Prosurfactant Protein C (ProSP-C) (Merck/Millipore/Sigma Aldrich, 1:500) followed by staining with polyclonal secondary antibody Goat anti-rabbit Alexa fluor 488 (Invitrogen,1:500) ...
-
bioRxiv - Physiology 2019Quote: ... following which they were treated with media containing 20% human serum (fed or fasted) and 1 µM puromycin (Merck Millipore Limited) for a further 4 h ...
-
bioRxiv - Microbiology 2019Quote: ... 500 μL of phage suspension (2 × 1010 PFU·mL-1) was mixed with 500 μL of extra pure chloroform (Merck Millipore™) and kept under 250 rpm·min-1 for 1 hour ...
-
bioRxiv - Bioengineering 2019Quote: ... The hPBMCs were washed, re-suspended in freezing medium (RPMI-1640 supplemented with 20 % FBS, 1 % P/S, and 10 % Dimethyl sulfoxide (Merck Millipore)) ...
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were collected in PBS in 24-well plates and processed for free-floating immunofluorescence using primary polyclonal antibodies that label neurons (NeuN, mouse; 1: 1000, Millipore MAB377, Merck Millipore), reactive astrocytes (GFAP ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the PCR fragment was amplified with the primers detailed in Supplementary Table 1 and purified in MultiScreen TM Vacuum Manifold 96-well plates (Merck Millipore). The purified PCR fragment was incubated with either the enzyme NlaIII or water (negative control ...
-
bioRxiv - Biophysics 2020Quote: ... dialyzed against Milli-Q water and concentrated to 4 mg ml-1 using Amicon Ultra centrifugal filter units with Ultracel-50K (Merck Millipore). UMODe filaments were obtained by limited digestion of UMODfl with elastase (Jovine et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... The blocking buffer was next replaced with rabbit polyclonal T22 antibody that recognises oligomeric Tau (diluted 1/2000) ((ABN454; Merck Millipore) (37) ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were fixed and stained according to the procedure described above using primary antibodies against NESTIN (Merck, ABD69, 1:300 dilution) and TUBB3 (Santa Cruz ...
-
bioRxiv - Neuroscience 2021Quote: ... The brains were removed and post-fixed for 1-2 days and then transferred to 30% sucrose (Merck KGaA, Darmstadt, Germany) dissolved in PBS ...
-
bioRxiv - Biophysics 2021Quote: ... and concentrated to >1.5 mg/mL.The DNA and antibody solutions were cross-reacted at a 10:1 molar ratio overnight and excess DNA was filtered through a 100 kDa Amicon spin column (UFC510096, Merck Milipore). The antibody-DNA solution was stored at 4°C.
-
bioRxiv - Genomics 2019Quote: ... heads of 10 ISO-1 females were chopped in 500 µL of ice-cold Otto 1 Buffer (0.1 mol/L citric acid, 0.5% Tween20 (Merck KGaA, Darmstadt, Germany)) ...
-
bioRxiv - Plant Biology 2021Quote: ... The eluate containing the nanodiscs was concentrated to 1 ml with the use of an Amicon Ultra-15 10K device (Merck Millipore) and then mixed with 10 ml of translation buffer containing 30 mM HEPES-KOH (pH 7.8 ...
-
bioRxiv - Biochemistry 2021Quote: ... truncatula leaf tissue was ground in liquid nitrogen and extracted three times in 1 ml of 80% HPLC-grade methanol (Merck, Germany). Each time the mixture was sonicated for 15 min at room temperature and centrifuged for 10 min at 15,000 ×g ...
-
bioRxiv - Plant Biology 2021Quote: ... 10 μL of the extract-reaction mixture was added to 1 cm2 P81 Phosphocellulose paper squares (MERCK MILLIPORE, Billerica, MA, USA). The papers were immersed directly in 1% (w/v ...
-
bioRxiv - Plant Biology 2021Quote: Arabidopsis seeds were surface sterilized with 1 mL 70% (v/v) ethanol containing 0.05% (v/v) Tween 20 (Merck, Darmstadt, Germany) by shaking on a table incubator at 1400 rpm for 3 min ...
-
bioRxiv - Biophysics 2021Quote: ... The DNA and antibody solutions were cross-reacted at a 10:1 molar ratio overnight and excess DNA filtered through a 100 kDa Amicon spin column (UFC510096, Merck Milipore). The antibody-DNA solution was stored at 4°C.
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 105 Cas9 TNG MKOS MEFs were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were dissolved in 1 ml of PBS and nuclei were stained with propidium iodide (PI) (Merck Millipore, Burlington, MA, USA) and analyzed using a flow cytometer (Guava PCA) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pellet obtained after the initial low-speed centrifugation was incubated in ice-cold IP buffer containing 1% NP-40 and 25-50 U of Benzonase (Merck, 70746) for 30 min on ice ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50% confluent cells were plated and allowed to adhere for at least 24 hours before treatment with 1 μM 4OH-TAM (Merck, H7904) or with identical volume of EtOH for the indicated time ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... followed by incubation in LI-COR blocking buffer containing rabbit polyclonal anti-P2X2 (#APR-003, Alomone labs; 1:2000) and mouse anti-Na+/K+-ATPase (05-369; EMD Merck Millipore) at 4 °C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... pooled and concentrated to roughly 0.5 – 1 mL by ultrafiltration spin units Amicon® Ultra–15 10 kDa MWCO (Merck-Millipore). Buffer was exchanged against storage buffer (40 mM Hepes (pH 7.4) ...
-
bioRxiv - Microbiology 2021Quote: ... The binding of CoVHH1-FLAG to S1 subunits-His tag was detected by incubating for 1 hour at room temperature with mouse monoclonal ANTI-FLAG® M2-Peroxidase (Merck) diluted with PBST ...
-
bioRxiv - Neuroscience 2021Quote: ... and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4, Merck KGaA, Germany) in 0.05 M sodium borate buffer ...
-
bioRxiv - Biochemistry 2021Quote: FLAG-CAHS1 was constructed using standard genetic engineering techniques with an N-terminal FLAG using a pT7-FLAG-1 vector (Sigma-Aldrich, Merck). The bacterial cells of E ...
-
bioRxiv - Microbiology 2021Quote: ... All samples were further concentrated to a final volume of 1-2 ml using 100 kDa Amicon-ultra filters (Merck Millipore).
-
bioRxiv - Cell Biology 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 10 kDa ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were then incubated for 1 hour with a species-appropriate HRP-conjugated secondary antibody (diluted 1:5000 in TBST) before bands were visualised using Immobilon Forte Western HRP Substrate (Merck Millipore). Primary antibodies used were mouse anti-αSMA (Dako ...
-
bioRxiv - Cell Biology 2019Quote: ... Total β1-integrin was detected by immunoblotting the membrane again with clone N29 anti-β1-integrin antibody (Merck, MAB2252, 1:1000) and appropriate secondary antibody and analysis on the Odyssey (LI-COR ...
-
bioRxiv - Immunology 2019Quote: ... and mouse monoclonal anti-DNA/Histona H1 antibody (1:100; catalog number 05-457/clone AE-4; Merck Millipore, MA, EUA). Alternatively ...
-
bioRxiv - Genomics 2019Quote: ... ChIP was performed on this chromatin extract using 1 µL of Anti-acetyl-Histone H4 (Lys16) Antibody (Merck Milipore, 07-329) or 0.5 µL of Histone H3 antibody mAb MABI 0301 (Active Motif ...
-
bioRxiv - Paleontology 2020Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Immunology 2021Quote: ... blocked in 5% BSA for 30 min and incubated ON with mouse anti-GAD67 monoclonal antibody (1:6000, MAB5406, Merck Millipore) or 1 h with rabbit polyclonal anti-GAPDH antibody (1:3000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated overnight at 4°C in blocking solution containing one of the following primary antibodies: anti-GFAP (1:2000; Merck Millipore) and anti-Iba1 (1:500 ...
-
bioRxiv - Microbiology 2019Quote: ... PfCERLI1HAGlmS parasites were transfected with the an episomal cytosolic GFP expressing plasmid pHGBrHrBl-1/2 and maintenance of this plasmid was selected for using 5 μg/mL blasticidin-S-deaminase HCl (Merck Millipore). Maintenance of the SLI-TGD plasmid was selected for using 20 μM WR99210 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lipids were resuspended in a small volume of chloroform/methanol (2:1) and applied to a to HPTLC plate (Silica Gel 60, Merck, Germany) together with DOPC/cholesterol and NeuGc/NeuAc GM3 as standards ...
-
bioRxiv - Physiology 2021Quote: ... Resulting lipid films were dissolved in 1 mL of n-hexane containing a C19:0 as internal standard (1.03 μg mL−1, CAS number 1731-94-8, Merck, Darmstadt, Germany) with addition of 200 μL of a solution of potassium hydroxide (KOH ...
-
bioRxiv - Microbiology 2021Quote: ... Aliquots of 10 μL were spotted into reverse-phase TLC (RP-TLC) plates (silica gel 60, RP-18, F254s, 1 mm, Merck, Germany). The plates were developed in chambers pre-saturated for 10 min using acetone as a solvent system ...
-
bioRxiv - Cell Biology 2020Quote: ... All supernatant was removed using a 1 ml syringe and the beads were resuspended in 30 μl 2X SDS Sample Buffer (Merck Millipore). The samples were incubated at 98°C for 5 minutes before electrophoresis.
-
bioRxiv - Biochemistry 2021Quote: ... with 0.1% (w/v) RapiGestTM SF surfactant (Waters, UK) and protease inhibitors (Roche cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail, Merck, UK).
-
bioRxiv - Biochemistry 2020Quote: ... epithelium suspension cell line expressing the EBNA-1 protein (female origin) was cultured in EX-CELL(r) 293 Serum-Free Medium (Merck, 14571C) containing 4 mM GlutaMAX supplement (TermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... fixed with a 4% PFA solution and stained for tyrosine hydroxylase (TH; rabbit anti-TH, 1:1000, Cat#: 657012, Merck Millipore) and neurobiotin (Streptavidin Alexa Fluor conjugate 647 ...
-
bioRxiv - Systems Biology 2021Quote: ... A volume of 1 mL supernatant was transferred to an LC glass vial using Millex-HV PVDF syringe filter tips (Merck Millipore). The HPLC column (Aminex 300-mm HPX-87H ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was removed with a 1 ml syringe and the beads were resuspended in 30 μl 2X SDS Sample Buffer (Merck Millipore). The samples were incubated at 98°C for 5 min and the samples were posteriorly collected by centrifuging for 5 minutes at 16000 xg.
-
bioRxiv - Microbiology 2020Quote: ... and the other stored at −80 °C in a sterile 2 ml cryovial containing 1 ml of a 30 % glycerol solution, prepared by diluting glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...