Labshake search
Citations for Merck :
3201 - 3250 of 3567 citations for Rat H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The dura was removed and a glass pipette connected to a Hamilton syringe containing LPC (1% in PBS; Merck, Germany) was lowered into the brain until 1.80 mm depth from the brain surface reaching into corpus callosum ...
-
bioRxiv - Molecular Biology 2022Quote: ... was assessed before and after induction with Doxycycline (1 μg/mL) by Western blot analysis using an anti-FANCJ (cat. B1310, Merck) and/or an anti-Flag antibody.
-
bioRxiv - Neuroscience 2022Quote: ... sections were mounted on slides and covered with an anti-fading medium using a mix solution 1:10 Propyl-gallate:Mowiol (P3130, SIGMA-Aldrich, Madrid, Spain; 475904, MERCK-Millipore ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 2 ml 4 °C PBS for 3 times and afterwards fixed in 1 ml of −20 °C cold methanol (Gradient grade for liquid chromatography, Merck) for 5 minutes at −20 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sonicated in 1 M KOH solution (6592-3705, Daejung) for 30 min and then washed with Milli-Q water (Direct 8, Merck) to remove remaining KOH solution ...
-
bioRxiv - Microbiology 2022Quote: ... wells were washed twice with warm PBS before incubation in 500 μL pre- warmed DMEM with 1% (v/v) Nutridoma (Merck) supplemented with 5 μM clickable sphingosine (Cayman Chemical ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 1% BSA/PBS and subjected to the Click-iT reaction in a solution containing 10 mM sodium ascorbate (Merck), 0.1 mM azide-PEG3-biotin conjugate (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... FOs were sonicated 2 x 10 sec in ice-cold 1:2 methanol/chloroform solvent containing SPLASH LIPIDOMIX MS standard internal standard mix (Merck). 1:6 H2O was added to the samples before shaking at 1000 rpm ...
-
bioRxiv - Microbiology 2024Quote: ... the amiloride-sensitive component (amilmax) was determined by adding 10 µM amiloride to the apical compartment or ouabain (1 mM, # O3125, Merck) to the basolateral chamber to calculate the maximal ouabain-sensitive Na,K-ATPase activity (ouabmax).
-
bioRxiv - Microbiology 2024Quote: ... from the resin was immediately neutralized with 1/10 faction volume of 1 M Tris-HCl pH 8.5 and concentrated using an Amicon Ultra-2 Centrifugal Filter Unit 100kDa NWMCO (Merck Millipore), in which the elution buffer was exchanged with PBS (GIBCO).
-
bioRxiv - Cell Biology 2024Quote: Samples were resuspended in 6 μL 40% (v/v) 1-propanol with vortexing and bath sonication were applied to Silica Gel 60 aluminium-backed HPTLC plates (MERCK) (30 ...
-
bioRxiv - Cell Biology 2024Quote: ... the cell pellet was resuspended in 400 μl of 40 μg/ml ultra-pure digitonin (Merck, CAS 11024-24-1) in vPBS and incubated (25 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffer was exchanged for 1× DPBS and LNPs were concentrated by centrifugation on Amicon 50 kDa filter unit (Merck #UFC805024). Size distribution and polydispersity index were determined using dynamic light scattering on Zetasizer Ultra Red (Malvern ...
-
bioRxiv - Neuroscience 2024Quote: ... Three baseline recordings were taken followed by three recordings after each of the following subsequent injections: 1 μM Oligomycin (Merck), 1 μM FCCP (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Neuroscience 2024Quote: ... or Tris-HCl buffered saline (TBS) and incubated at 4°C overnight with primary antibodies (anti-Nr4a2, Abcam, ab41917, 1:500 dilution; anti-GluA1, Merck-Millipore ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting cell pellet was freeze-thawed thrice and re-suspended to 10% (w/v) in a lysis buffer containing 5% (v/v) Polysorbate 80 and 20 U mL−1 benzonase (Merck). After 1 h incubation at 37 °C ...
-
Insight into the regulatory mechanism of the MFS transporter, SCO4121 by the MarR regulator, SCO4122bioRxiv - Molecular Biology 2024Quote: ... the MSA agar plate was flooded and 500 µg/ml of nalidixic acid (Himedia) and 1 mg/ml of apramycin (Merck). After incubation ...
-
bioRxiv - Developmental Biology 2024Quote: ... sequential semithin sections (1 um) were obtained and stained with a solution of 0.5% toluidine blue O (Merck, Darmstadt, Germany) for light microscopy to select cardiac regions comprising the atrioventricular canal and outflow tract ...
-
bioRxiv - Molecular Biology 2024Quote: ... were mixed at a ratio of 4:1 based on monomer and injected onto a gel-filtration column (Superdex 200, 16/600, Merck) equilibrated in 20 mM HEPES buffer (pH 8.0) ...
-
bioRxiv - Cell Biology 2024Quote: ... and Pb external calibrations were prepared from 1 g/L stock solutions (Carl Roth, Centipur® Merck, or VHG Labs). Se was quantified by isotope dilution analysis (IDA ...
-
bioRxiv - Microbiology 2024Quote: ... the A549 cells were washed once with 1× phosphate-buffered saline (PBS) before incubating again with 100 µL of 0.5 mg/mL of MTT reagent (Merck, Germany) for 3 h at 37°C to allow the formation of purple formazan ...
-
bioRxiv - Microbiology 2024Quote: ... The pellet was resuspended in RNA solubilization buffer (20 mM dithiothreitol (Vivantis, Malaysia) and 1 mM sodium citrate (Merck, Germany). The yield and purity were determined with a BioDrop Spectrophotometer Duo (Biochrom ...
-
bioRxiv - Cancer Biology 2024Quote: ... The lyophilized peptides were resolubilized in 80 % acetone with 1 % TFA and loaded onto an ihouse ZIC-HILIC micro-column containing 30 mg of ZIC-HILIC particles (Merck Millipore ...
-
bioRxiv - Cancer Biology 2024Quote: ... Only treatment naive patients that underwent anti-PD-1 monotherapy with either pembrolizumab (200 mg IV every 3 weeks or 400 mg IV every 6 weeks, Merck) or nivolumab (240 mg IV every 2 weeks or 480 mg IV every 4 weeks ...
-
bioRxiv - Cell Biology 2024Quote: ... and pcDNA5/FRT/TO/2K-NS4B-3xFLAG-APEX2 in 9:1 (w/w) ratio using GeneJuice transfecting agent (Sigma-Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in T cell medium for 30 min at 37°C without any metabolic inhibitors or in presence of 1 μM oligomycin (Merck), 100 mM 2DG (Merck) ...
-
bioRxiv - Systems Biology 2023Quote: ... UK), eosin Y 1% alcoholic and xylene (CellPath, UK), periodic-acid (TCS Biosciences Ltd, UK) and Schiff’s reagent (Merck, Germany). Description of the IF and IHC antibodies used can be found in the Supporting Information.
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 50 µL chloroform : methanol (2 : 1) and 5 µL were loaded on silica gel 60 F254 plates (Merck). To separate trehalose esters of mycolates (TDM ...
-
bioRxiv - Developmental Biology 2023Quote: ... Product number E4250) (1 mg/ml) to contract pigment cells alongside 0.01% Tricaine (Ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich (Merck) Product number E10521 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were washed three times with 0.1% PBST and incubated at RT for 1 hour with horseradish peroxidase-conjugated secondary antibody (Cat No. NA934, Merck Millipore) diluted 1:1,000 in 0.05% PBST ...
-
bioRxiv - Neuroscience 2022Quote: ... whole plasmids (Entry plasmids containing cmk-1 coding DNA sequences) were amplified with the KOD Hot Start DNA Polymerase (Novagen, Merck). Primers were phosphorylated in 5’ and were designed to contain the desired point mutation(s ...
-
bioRxiv - Microbiology 2023Quote: ... binding of equine antibodies was detected by incubation for 1 hour with protein A conjugated to peroxidase (GE) and visualized with chemiluminescence reagent (ECL, Merck). Images were obtained with an Odyssey LI-COR instrument ...
-
bioRxiv - Microbiology 2023Quote: ... 1[µg of total RNA from each of three independent experiments was digested with DNase I (Merck Ltd. Budapest, Hungary) following the manufacturer’s instructions ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... the slices were washed three times with a blocking buffer containing 1% bovine serum albumin and 0.25% Triton-X in phosphate buffer saline (PBS) and then incubated with primary antibodies (anti-tyrosine hydroxylase, rabbit polyclonal, 1:1000, Merck Millipore ...
-
bioRxiv - Biochemistry 2023Quote: ... membranes were blocked with 5% BSA in TSMT (20 mM Tris; 150 mM NaCl, Merck; 1 mM CaCl2, Sigma; 2 mM MgCl2, Merck; adjusted to pH 7 with HCl ...
-
bioRxiv - Cell Biology 2023Quote: Proximity ligation assays with Aurora A kinase and MP-GAP were performed in HeLa cells using mouse anti-Aurora A Kinase antibody (1:500, A1231 Merck), rabbit anti-MP-GAP antibody (1:250 ...
-
bioRxiv - Bioengineering 2023Quote: ... The pre-adipocytes were plated in custom-made plates (Supp. Fig. 15b) and cultured in growth medium -low glucose (1g l-1) DMEM (Merck) supplemented with 10% FBS (Merck) ...
-
bioRxiv - Evolutionary Biology 2023Quote: The frozen cell pellet was homogenized in RIPA buffer (Fujifilm, Osaka, Japan) containing 1/100 (v/v) in a final volume of Protease Inhibitor Cocktail (Merck) for 30 min at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Japan) in 1× PBS for 20 min at room temperature and then incubated with the anti-ADAR antibody HPA051519 (Merck) diluted 1:200 with PBS for 12 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...
-
bioRxiv - Cell Biology 2023Quote: ... reagent (chlortrimethylsilane [Merck KGaA, Darmstadt, Germany]/1.1.1.3.3.3-Hexamethyldisilasane [Sigma Aldrich, Co., St. Louis, MO, U.S.A]/pyridine [Merck KGaA, Darmstadt, Germany], 9:3:1) in a GC vial for GC-MS-SIM non-cholesterol analysis ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were lysed in RIPA buffer supplemented with protease and phosphatase inhibitor cocktail and 1 μM PARG inhibitor ADP-HPD (Merck). For chromatin fraction ...
-
bioRxiv - Biophysics 2023Quote: ... and was subsequently concentrated to 1 mL using a 100 kDa cut-off Amicon ultra centrifugal filter (Merck Millipore, Germany). The concentrated protein sample was further purified by size exclusion chromatography (SEC ...
-
bioRxiv - Developmental Biology 2023Quote: ... Haematoxylin and Eosin staining was performed on few ST muscle sections by incubating the slides at RT for 1 min in hematoxylin solution (Merck). Slides were then washed for 10 min in running tap water before incubating for 1 min in eosin solution (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then acquired on the flow cytometer for ~25 seconds before the addition of 1 μg/mL ionomycin (Merck), and calcium flux was measured for ~1.5 mins.
-
bioRxiv - Cell Biology 2023Quote: ... The pooled fractions were diluted with 2 vols of KPEM buffer to achieve a final concentration of 125 mM KCl and then incubated for 1 hr with 4 mL anti-FLAG monoclonal antibody conjugated resin (M2 agarose, Merck) using rolling ...
-
bioRxiv - Bioengineering 2023Quote: ... Then these samples were incubated in Alexa Fluor 488 conjugated mouse monoclonal anti-CTSK antibody (1:100) at 4°C overnight (Merck) and then for 1h under agitation at room temperature ...
-
bioRxiv - Microbiology 2023Quote: R47 and R32 wild type strains were inoculated and grown in 6-well plates as described in the RNA extraction section except that 1 ml 0.38 M NaOH (Merck, Germany) was added to the middle two wells to capture HCN in the surrounding ...
-
bioRxiv - Developmental Biology 2022Quote: Organoids were washed with DPBS without calcium and magnesium and added to a 9:1 mixture of Accutase (Merck, A6954) and 10x Trypsin (Thermo Fisher Scientific ...