Labshake search
Citations for Merck :
251 - 300 of 367 citations for Recombinant Human Metadherin GST tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Mission siRNA for human Pacsin 2 siRNA (SASI_Hs01_0021-5538, SASI_Hs01_0021-5539 and SASI_Hs01_0021-5540, Merck) or MISSION siRNA Universal Negative Control #1 (SIC-001 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Calibration curve samples were generated by diluting the International Standard with human plasma (Merck) to create a standard curve ranging from 955 000 IU/mL to 95.5 IU/mL with three technical replicates of each concentration ...
-
bioRxiv - Cell Biology 2024Quote: Human embryonic kidney (HEK293) cells were cultured in Dulbeccoʹs Modified Eagleʹs Medium (DMEM, Merck) containing 10% Fetal Calf Serum and 1% Antibiotic Antimycotic Solution (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human kindlin2 (mouse monoclonal, 3A3, Merck, MAB2617; WB 1:1000, IF 1:200), anti-mouse kindlin2 (rabbit polyclonal ...
-
bioRxiv - Developmental Biology 2023Quote: ... injection of 5 IU of human chorionic gonadotrophin (hCG; Pregnyl, Merck, Kilsyth, VIC, Australia) 48 h later.
-
bioRxiv - Genetics 2024Quote: ... Spermatozoa were capacitated in Human Tubal Fluid medium (HTF) (Merck Millipore; MR-070-D) supplemented with 10 mg/ml Albumin (Sigma ...
-
bioRxiv - Immunology 2024Quote: The MILLIPLEX MAP Human CD8⁺ T-Cell Magnetic Bead Panel (Merck Millipore Darmstadt, Germany) was used to quantify GM-CSF ...
-
bioRxiv - Biophysics 2024Quote: ... A reference molecule [(Glu1)-fibrinopeptide B human (CAS No 103213-49-6, Merck, USA)] was used to lock mass with an expected molecular weight of 785.8426 Da ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bound TSP-1 was detected using a mouse anti-human TSP-1 (Merck, MABT879) antibody for 2 h at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... HeLa cells were transfected with pre-designed siRNA targeting human TNFRSF1A (Sigma-Aldrich/Merck, #SASI_Hs01_00033456 ...
-
bioRxiv - Neuroscience 2024Quote: ... human cerebral organoids were fixed for 60 min in 4% PFA (MC1040051000, Merck, Germany). Afterwards the tissues were incubated in 30% sucrose in DPBS (14190-094 ...
-
bioRxiv - Bioengineering 2021Quote: ... Part A consisted of 20% hPL (v/v) and 4mg/mL human fibrinogen (Merck, USA) in DMEM/F12 (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... and goat anti-Human IgG (Fc specific)-Cy3 (1:1000 dilution in binding buffer; Merck). Finally ...
-
bioRxiv - Immunology 2021Quote: ... MIP-1β by MILLIPLEX MAP Human High Sensitivity T Cell Panel (Merck Cat# HSTCMAG-28SK) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... Two hundred microliters of medium containing 2 μM human insulin (Merck, Sigma-Aldrich Cat# I9278) or medium only was added to the thoraxes for 10 min (the final concentration of insulin was 1 μM) ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T cells (ATCC) and FibroGRO Xeno-Free human foreskin fibroblasts (Merck, gift from Martin Lowe) were maintained in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Microbiology 2023Quote: ... and NTK seeded on surfaces coated with 100 μg/ml type IV human collagen (Merck) in defined keratinocyte serum-free medium (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... All human cell lines were cultured at 37℃ in 5% CO2 in DMEM media (Merck) containing 1% antibiotic (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membrane was blotted with the following antibodies: anti-human PSEN1-CTF (MAB5643; Merck Millipore); anti-PEN2 (D6G8 ...
-
bioRxiv - Immunology 2023Quote: ... cells were cultured in RPMI 1640 (ccpro) supplemented with 10 % heat-inactivated human serum (Merck), 50 U/ml IL-2 (Miltenyi) ...
-
bioRxiv - Microbiology 2023Quote: ... Primers for human H19 were used as a positive control for CTCF binding (Merck Millipore).
-
bioRxiv - Immunology 2024Quote: ... CCL4 and CX3CL1 with the MILLIPLEX MAP Human High-Sensitivity T cell Panel (Merck Millipore). Thawed plasma aliquots were centrifuged at 13,000 r.p.m ...
-
bioRxiv - Bioengineering 2024Quote: ... was prepared by coating it with human fibronectin solution (Cat. FC010, Merck KgaA, Darmstadt, Germany) at a concentration of 50 µg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% P/S and 6 ng/mL human insulin (I9278-5ML, Merck Life Science bv). The cell culture was checked for mycoplasma contamination with the MycoAlert® Mycoplasma Detection Kit (LT07-118 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Xenopus females were primed for spawning by injecting 50 units human chorionic gonadotropin (CG, Merck) 3-6 days before embryos were needed ...
-
bioRxiv - Genetics 2024Quote: Human embryonic kidney (HEK)-293T cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Merck) supplemented with 4 mM L-glutamine ...
-
bioRxiv - Immunology 2021Quote: ... The MILLIPLEX®MAP Human Isotyping Magnetic Bead Panel-Isotyping Multiplex Assay (HGAMMAG-301K-06, Merck) was used to measure IgG1 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Human Caco-2 colorectal adenocarcinoma cells (1.7×105 cells/cm2) were cultured in DMEM medium (Merck) containing 10% FCS at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... medium was further exchanged with FibroGRO™ Complete Media Kit for Culture of Human Fibroblasts (Merck), consisting of a fibroblasts-specific basal media supplemented with P/S (0.5%) ...
-
bioRxiv - Microbiology 2023Quote: ... and mouse anti-human TMPRSS2 (monoclonal, clone P5H9-A3, cat num: MABF2158, 1:500, MERCK, USA) for a minimum of 2 h at RT ...
-
bioRxiv - Bioengineering 2023Quote: ... the chips were coated with fibronectin (Human Plasma Fibronectin Purified Protein, Merck, Schiphol-Rijk, The Netherlands) in sterile PBS (100 μg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mg/l hydrocortisone and 1 µg/l and human epidermal growth factor (hEGF) (both Merck). To determine EC sex ...
-
bioRxiv - Neuroscience 2024Quote: Rodent as well as human brain slices were stained using the antibodies NeuN (MAB377, MilliporeSigma (Merck), 1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... Human embryonic kidney (293T) cells were maintained in the Dulbecco’s Modified Eagle Medium (D6046, Merck, Darmstadt, Germany) supplemented with 10% fetal bovine serum (FB-1365 ...
-
bioRxiv - Bioengineering 2021Quote: The sEVs used to validate the platform were collected from a commercial human serum purchased from Merck Millipore (same lot in all preparations ...
-
bioRxiv - Neuroscience 2021Quote: ... The concentrations of Aβ40 and Aβ42 were determined in brain lysates using the ELISA kits according to the manufacturer’s instructions (human Aβ40 and Aβ42 brain ELISA, Merck).
-
bioRxiv - Genomics 2022Quote: ... females and males were primed with 20 U and 10 U human chorionic gonadotropin (hCG, Pregnyl, Merck), respectively ...
-
bioRxiv - Immunology 2022Quote: ... Human peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll density gradient centrifugation (GE-171440-02, Merck), collected from the interphase ...
-
bioRxiv - Neuroscience 2022Quote: ... C3 and C1 were analyzed with HCMP2MAG-19K-02 Human Complement Magnetic Bead Panel 2 (Merck Millipore). Supernatants from non-stimulated CTL and L2-PD astrocytes cultured for 14 days were collected and stored at −80°C for long storage ...
-
bioRxiv - Cell Biology 2023Quote: ... fully mature Xenopus females were injected with 260 U of human chorionic gonadotropin (hCG; Merck, Ovitrelle 250G) into the dorsal lymph sac about 12-16 h before use and kept overnight at 18 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were sub-cultured on days 4 and 8 of differentiation onto human fibronectin (Merck Millipore, #FC010) coated plates at a ratio of 1:4 ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cell Biology 2024Quote: The EMD MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Pane A – Immunology Multiplex Assay (Merck Millipore) was employed to simultaneously analyze TNF-α ...
-
bioRxiv - Neuroscience 2020Quote: ... RIPA and FA fractions was assessed using the Human Aβ1-42 enzyme-linked immunosorbent assay (ELISA) Kit (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: Primary human macrophages (pMФ) were isolated from the whole blood of healthy volunteers with Biocoll separating solution (Merck) according to the manufacturer’s protocol and seeded at a density of 2×106 cells per well in a 6-well plate ...
-
bioRxiv - Biochemistry 2020Quote: ... Human Rab8a 6-176aa (referred to as Rab8a)-encoding DNA was cloned into a pet51b(+) vector (Merck Millipore), resulting in a construct with a N-terminal Strep® II tag and enterokinase cleavage site and a C-terminal 10xHis tag ...
-
bioRxiv - Biochemistry 2020Quote: ... at increasing concentrations (3.8 pM–250 nM) in the presence of 90% heat-inactivated human serum (H5667, Merck) and incubated at 4 °C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... The human macrophage-like cell line U937 (ATCC no. CRL-1593.2) was cultured in RPMI-1640 medium (Merck) supplemented with 10% iFCS ...
-
bioRxiv - Cell Biology 2021Quote: Human hTERT RPE-1 cells (ATCC, CRL-4000) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM/F12, Merck) supplemented with 10% fetal calf serum (FCS) ...