Labshake search
Citations for Merck :
2551 - 2600 of 2677 citations for 6 Phenylamino 2 3 dihydro 1H indolizin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... All samples were further concentrated to a final volume of 1-2 ml using 100 kDa Amicon-ultra filters (Merck Millipore).
-
bioRxiv - Cell Biology 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 10 kDa ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were subsequently washed with PBS and incubated for 2 h with the proper secondary antibodies (1:300, goat anti-rabbit Alexa-Fluor® 647, AP187SA6, Merck Millipore ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Growth experiments were performed on YNB medium with 1 or 2 % methanol supplemented with 1 g/L yeast extract (Merck 103753). Optical density readings at 600 nm (OD600 ...
-
bioRxiv - Plant Biology 2020Quote: ... tumefaciens were resuspended in 50 mM MES (2-Morpholinoethanesulfonic acid hydrate) (Duchefa, Haarlem, The Netherlands) - KOH buffer (pH 5.6) containing 2mM NaH2PO4 (Merck, Darmstadt, Germany), 100 µM acetosyringone (Sigma-Aldrich ...
-
bioRxiv - Paleontology 2020Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Microbiology 2020Quote: ... used for barrier dysfunction experiments were conducted on a 37 °C heating block using a Millicell ERS-2 Voltohmmeter (Merck-Millipore) equipped with an Ag/AgCl electrode (STX01) ...
-
bioRxiv - Molecular Biology 2021Quote: TEER measurements [22] were performed on 3rd day of incubation with growth factors and (or) different inhibitors by using Millicell ERS-2 Electrical Resistance System (Merck-Millipore). Each insert was measured in three different locations ...
-
bioRxiv - Molecular Biology 2020Quote: ... we repeated the experimental protocol and behavioral battery in wild type zebrafish larvae using 2 μM THC (Merck, Cat. No. T4764), and 0.15 μM nicotine (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... Fractions containing the desired His6-tagged protein were concentrated to 2 ml using Amicon® Ultra Centrifugal Filters (10,000 MWCO, Merck Millipore), and were directly injected into a size-exclusion chromatography column (Superdex 75 16/60 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lipids were resuspended in a small volume of chloroform/methanol (2:1) and applied to a to HPTLC plate (Silica Gel 60, Merck, Germany) together with DOPC/cholesterol and NeuGc/NeuAc GM3 as standards ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 2 μl of the enzyme β-glucuronidase (from Helix from Pomatia enzyme aqueous solution, ≥ 100.000 units/mL; Merck, Darmstadt, Germany) to deconjugate DEHP metabolites and BPA ...
-
bioRxiv - Microbiology 2020Quote: ... and the other stored at −80 °C in a sterile 2 ml cryovial containing 1 ml of a 30 % glycerol solution, prepared by diluting glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Immunology 2021Quote: Cytokine and chemokine levels produced by PCLS after 2 dpi were assessed in a Multiplex assay in supernatants (dilution 1:2) with MILLIPLEX® Bovine Cytokine/Chemokine Panel 1 (BCYT1-33K-PX15, Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... tumors were enzymatically digested with 2,000 U/mL of DNase I and 2 mg/mL of collagenase IV (both from Sigma Aldrich, Merck, Israel) in HBSS for 30 min 37 □ ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fractions corresponding to the elution peak were selected and concentrated to 2-50 mg/mL through the use of Amicon® Ultra-15 Centrifugal Unit (Merck), frozen and stored at −80°C for downstream experiments ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Cell Biology 2022Quote: ... femurs and tibias of C57BL/6J mice were extracted and crushed on a mortar in PBS supplemented with 4%FBS and 2 mM EDTA and filtered through 0.45μm strainers (Merck Millipore, Cat#SLHV033RB). For B cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Zoology 2023Quote: ... it was fractionated into the different fatty acid classes over an activated silicic acid column (heated at 120ºC for 2 h; Merck Kieselgel 60) via eluting with 7 ml chloroform ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfectants with stably integrated GOI were then selected based on their resistance to G418 (0.5 mg/ml, 1-2 weeks, Merck, Cat.N. G8168). To induce the expression of the GOI the cells were treated with doxycycline (2 μg/ml ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...
-
bioRxiv - Microbiology 2024Quote: ... ParT (S48C)-His6 and ParT (Q271C)-His6 aliquots were supplemented with 1 mM tris (2-carboxyethyl) phosphine hydrochloride (Merck; cat# C4706) before flash-freezing in liquid nitrogen.
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5 mM TCEP) and concentrated to approximately 5 ml using an Amicon® Ultra Centrifugal Filter Ultracel®-3K (UFC900324, Merck/Millipore, Darmstadt, Germany) before loading onto a HiTrap™-Heparin HP column (Cytiva ...
-
bioRxiv - Immunology 2020Quote: Following protein digestion a 5% volume of the peptide solution was cleaned up with a reverse phase (C18) ZipTip (Merck Millipore, Burlington, MA, USA). The peptide sample was acidified with the addition of 1 μl 1M hydrochloric acid ...
-
bioRxiv - Immunology 2022Quote: ... Tissue samples for RNA-protein extraction were cut into small pieces (< 5 mm) and placed in a microcentrifuge tube containing RNAlater® solution (Merck Ltd, Dorset, UK) and stored at −70°C until further use.
-
bioRxiv - Plant Biology 2022Quote: ... Spore concentration was counted via haemocytometer and adjusted to 1 x 105 spores per mL in 0.1% gelatin or dH2O with 0.01% Tween 20 (Merck Chemicals, CAS Number: 9005-64-5).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: HPLC separations were performed on a Waters 2695 separations module equipped with a Waters 2996 photodiode array detector and HPLC analysis was carried out using a LiChrospher® 100 RP-18 column (4 mm × 250 mm, 5 μm) (Merck, Kenilworth, NJ, USA). The mobile phase consisted of two solvent reservoirs ...
-
bioRxiv - Neuroscience 2024Quote: ... each sample was separated on 5-20% gradient e-PAGEL mini gels (ATTO Corporation, Tokyo, Japan) and transferred to polyvinylidene fluoride membranes (Merck Millipore, Billerica, MA, USA). The membranes were incubated for 30 min with blocking buffer (Nacalai Tesque) ...
-
bioRxiv - Cancer Biology 2023Quote: ... diluted 1:1000) and vinculin loading control (Cell signalling #4650, diluted 1:1000) in 5% bovine serum albumin (BSA) (Merck, Kenilworth, NJ, United States)/TBS-Tween overnight at 4° C ...
-
bioRxiv - Biochemistry 2021Quote: ... PTP1B KO Ramos were transfected with a doxycycline inducible tet-on vector and exposed to 2 μg/ml doxycycline (Calbiochem, Merck, Darmstadt, Germany) 24 to 48 h before the experiment ...