Labshake search
Citations for Merck :
201 - 250 of 3532 citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM K4Fe(CN)6 and 1 mg/ml X-gal (Roth)) and counterstained with nuclear fast red (Merck) for 5 min ...
-
bioRxiv - Physiology 2022Quote: ... cultures were fixed with 4% PFA and stained with 2% Alizarin red S (Merck). For the quantification ...
-
bioRxiv - Developmental Biology 2024Quote: ... grids were post-stained with 2% aqueous uranyl acetate at pH 4 (Merck, Germany) and Reynold’s lead citrate ...
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1 mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 4 h with 5 mg/ml Brefeldin A (Merck, Darmstadt, Germany) after 140 h incubation time ...
-
bioRxiv - Molecular Biology 2023Quote: ... then the mixture was dialyzed against histone refolding buffer at 4 □ using a dialysis tube (D-TubeTM Dialyzer Medi or Maxi, MWCO 6-8 kDa, Merck). HE buffer (10 mM HEPES ...
-
bioRxiv - Biochemistry 2024Quote: Peak fractions from size-exclusion chromatography were concentrated to 4-6 mg mL-1 using a 50 kDa MWCO spin column (Merck), followed by addition of 30 mM D-glucose ...
-
bioRxiv - Biophysics 2020Quote: ... Refolded I-Ek/MCC(ANP)-biotin complexes were purified via 14.4.4S mAb-based affinity chromatography (Cyanogen bromide-activated Agarose, MERCK) followed by gel filtration (Superdex-200 10/300 GE Healthcare Life Sciences) ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Biophysics 2024Quote: ... The 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck (Darmstadt, Germany). Cholesterol (Chol ...
-
bioRxiv - Microbiology 2023Quote: ... LB plates were seeded with the different cultures and Whatman n° 1 filter discs (6 mm) were impregnated with 5 μl of 30% (v/v) H2O2 (Merck) as previously described [31] ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal anti-α-tubulin clone B-5-1-2 (Merck T5168; 1:5000), mouse monoclonal anti-EF-18 clone A-5 (Santa Cruz Biotechnology sc-393731 ...
-
bioRxiv - Neuroscience 2024Quote: ... IL-10 and TNF-α were quantified in the FN of NL and at 21dpi aged GFAP-IL6Tg and WT mice (n= 4-6/experimental group) using a Milliplex MAP Mouse High Sensitivity kit (#MHSTCMAG-70K; Merck Millipore), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... the slices were cultured for 4-6 days onto culture membranes (uncoated 30 mm Millicell-CM tissue culture inserts with 0.4 mm pores, Merck Millipore, Germany) and kept in six-well dishes (BD Biosciences ...
-
bioRxiv - Immunology 2020Quote: ... naïve T cells were freshly isolated and subsequently cultured for 4/5 days in RPMI (Merck), containing 10% Heat Inactivated FCS (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 10% 2-mercaptoethanol at a 4:1 ratio (Merck, Sigma-Aldrich, cat. M6250) and heated at 55 °C for 7 min ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Physiology 2024Quote: ... 5 min incubation at room temperature with 100 µL 1-Bromo-3-chloropropane (BCP) (Merck, Darmstadt, Germany, #B9673) was performed ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... dried tissue samples (in liquid nitrogen) were dissolved in 3:2:1 mixture of HNO3 (Merck, Germany), H2SO4 (Merck ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5×105 cells were grown until confluence in 0.2 mg/ml collagen-type I-coated 6 well plates (Merck, Darmstadt, Germany) and incubated in serum-free medium for 24 h with/without Dox treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... we seeded cells at 2 * 106 cells/ mL in S2 media in 2 mL media/ well in a 6-well plate with either DMSO (D2650, Merck), 2.5 μM CytD (C2618 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then plated at a density of 500 cells/cm2 into 6-well plates coated with 1.2% poly(2-hydroxyethylmethacrylate) (Merck, Germany) in 95% ethanol (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... a total of 0.4–0.5 μg of plasmid and dsRNAs were transfected into BmN4 cells (4–6 × 104 cells per glass bottom 35 mm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche), and the cells were fixed 5–6 days later ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on manufacturer-suggested minimum seeding density) with lenti/retroviral supernatant in a 1:1 volumetric ratio and 8 µg/mL hexadimethrine bromide (Merck), before centrifugation at 900g for 30 min and returning to incubation at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2023Quote: ... The 1.5 ml resuspended RBCs were cultured in 50 ml HPS containing 2 mM CaCl2 and 2 µM calcium ionophore-4-bromo-A23187 (C7522, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) in T75 flasks in a 5% CO2 incubator at 37°C for 16 h ...
-
bioRxiv - Biochemistry 2020Quote: ... and a SeQuant ZIC-HILIC precolumn (5 μm particles, 20 × 2 mm) (Merck, Darmstadt, Germany) using a linear gradient of mobile phase A (5 mM NH4OAc in acetonitrile/H2O (5/95 ...
-
bioRxiv - Immunology 2022Quote: ... Peritoneal cavity cells were obtained by lavage with 5 mL PBS + 2 mM EDTA (Merck). Following gentle massage ...
-
bioRxiv - Biochemistry 2024Quote: ... After 2 days incubating with 5 μM ROCK Inhibitor (Y-27632, RI, from Merck Millipore), 40 μM TGF-β inhibitor (SB 431524 ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM sodium ascorbate) on ice and filtered through 2 layers of Miracloth (Merck Millipore). Intact chloroplasts were collected from a band at the interface between the 40 % (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... which then were transferred into 4-5 fold bigger volume of cOmpleteTM Protease Inhibitor Cocktail (Roche, Merck) in PBS and gently mixed for 30 minutes to aid HA dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 M urea (Merck), 1% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... each coverslip was washed with PBS 3 times each for 5 minutes and nuclei were stained with Hoechst (Merck Sigma ...
-
bioRxiv - Biophysics 2022Quote: The dyes used in this study and the working dilutions were: 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine (LAURDAN, 4.5 μM, Sigma-Aldrich, Merck, #40227), Hoechst 33342 (80 uM ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...