Labshake search
Citations for Merck :
51 - 100 of 3532 citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Cell Biology 2024Quote: ... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Neuroscience 2022Quote: ... cells nuclei were stained with DAPI (4′,6-diamidino-2-fenilindol, 1:10000, Merck, cat#D9542) for 5 minutes at RT and mounted in Lab Vision™ PermaFluor™ Aqueous Mounting Medium (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 μl 0.2 μg/ml 4’,6’-diamidino-2-phenyl-indole (DAPI, Merck, catalog no. D9542) in PBS was added for 15 min at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were then incubated with 4’,6-diamidino-2-phenylindole (DAPI; 1:5,000; Merck Millipore) and covered with Mowiol (Merck Millipore ...
-
bioRxiv - Developmental Biology 2023Quote: ... gastruloids were incubated with secondary antibodies and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4°C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... Ovaries were washed again and incubated in DAPI (4’,6-diamidino-2-phenylindole 1 μg/mL, Merck) for 5 min at room temperature.
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated for 10 minutes in 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000, Merck, Italy, D9542), to allow visualization of cell nuclei ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with the nucleus DNA stain 4′,6-diamidino-2-phenylindole (DAPI) (1μg/ml D9542-10MG, Merck Life Science UK Ltd ...
-
bioRxiv - Biochemistry 2024Quote: ... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
bioRxiv - Biochemistry 2022Quote: ... Hexyltriphenylphoshonium bromide was obtained from Merck (842007). Actinomycin D (A1410) ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Neuroscience 2024Quote: ... The amplicons were resolved by electrophoresis in a 2% agarose gel stained with ethidium bromide (0.5 ug/ml, Merck), and MW markers 100 bp DNA ladder (Promega ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Gels contained 0.5 μg/m Ethidium Bromide (Merck) to visualise DNA using a UV transilluminator supplied by GeneSys ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Immunology 2024Quote: ... 2-DG (5 mM; Merck), DMM (10 mM ...
-
bioRxiv - Genomics 2024Quote: ... 20 mL of pre-heated (65°C) modified Cetyltrimethylammonium bromide (CTAB) extraction buffer [2% CTAB (H-5882, Merck, Darmstadt, Gerrmany); 100 mM Tris-HCl (pH8.0) ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL lipid extract was injected on a LiChroCART 250–4 LiChrospher® Si 60 (5 μm) (Merck) maintained at 25 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 μM of the protease inhibitor 4-(2-aminoethyl)-benzolsulfonyfluorid hydrochloride (BioChemica) and 5 U/mL-benzonase (Merck) were added (final concentrations) ...
-
bioRxiv - Bioengineering 2021Quote: ... INS-1 cells in bioprinted grid scaffolds were stained with thiazolyl blue tetrazolium bromide (MTT) after 5 days in culture according to the manufacturer’s protocol (Merck, Darmstadt, Germany). Proliferation was determined using an ATP-based assay with luminescent readout (CellTiter-Glo® 3D Cell Viability Assay ...
-
bioRxiv - Immunology 2020Quote: Survival was determined by assessing the fraction of vital cells at defined time points during culture by flow cytometric exclusion of 4’,6-Diamidin-2-phenylindol (DAPI) (Merck, Darmstadt, Germany) and Annexin V-APC (BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... and incubated under 365 nm UV-light for 15 min with 666 µg sulfosuccinimidyl 6-(4-azido-2-nitrophenylamino)hexanoate (sulfo-SANPAH, Sigma-Aldrich, Merck, 803332) diluted in 10 mL sterile dH2O ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dried pellet was mixed with Lysis buffer (9M urea, 4 wt% CHAPS, 2% Pharmalyte carrier ampholyte pH 3-10, Merck) and left overnight at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... Coverslips were rinsed in distilled water and mounted using Mowiöl (12 ml of 0.2 M Tris buffer pH 7.5, 6 ml distilled water, 6 g glycerol, 2.4 g Mowiöl 4-88, Merck Millipore). Samples were imaged immediately or within the next 48 h ...
-
bioRxiv - Cell Biology 2021Quote: ... were applied for one hour at room temperature and cells were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck G8294; 1:3000) before mounting with Fluoromount™.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: 5-bromo-2-deoxyuridine (BrdU) (Merck) immunofluorescence staining was performed to assess the influence of ECM stiffness on MCF10A proliferation ...
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...