Labshake search
Citations for Merck :
201 - 250 of 2009 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... polyclonal α-GAPDH (1:1,000; Merck Millipore, AB2302), and polyclonal α-Parkin (1:2,000 ...
-
The loss-of-function of SOCS2 increases the inflammatory response to Staphylococcus aureus infectionbioRxiv - Immunology 2023Quote: ... and TNF-α (Milliplex-MAP, Merck Millipore, France) and a xMAP instrument (MAGPIX ...
-
bioRxiv - Biochemistry 2023Quote: Initial substrate screens on pNP-α-Araf (Merck), pNP-β-Xyl (Merck) ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse anti-Acetylated-α-tubulin (Sigma/Merck #T6793) was used as a primary antibody (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-α tubulin (Merck, #T6074, 1:500), mouse anti-tubulin acetylated (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... and α -EF1α: (1:80,000, Merck 05-235). Both primary antibodies were diluted in solution of TBS-T with 2.5% powdered milk and incubated for 1 h at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... microglia were treated with vehicle (PBS, 24 h, Merck), LPS (100 ng/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... for 24 hours or with mimosine (0,5mM, Merck Millipore)/aphidicolin (400nM ...
-
bioRxiv - Microbiology 2022Quote: ... and stop solution (0.16 M Sulfuric Acid (Merck cat. No. 7664-93-9)) were prepared in-house ...
-
bioRxiv - Systems Biology 2023Quote: Caspase-9 activity was measured in liver lysate according to manufacturer’s protocol (Merck Caspase-9 Colorimetric Activity Assay Kit APT139 ...
-
bioRxiv - Microbiology 2023Quote: ... 10 mM HEPES pH 7.2 (Merck, Darmstadt, Germany; CAS-No: 7365-45-9). TaC12 cells were washed with PBS and incubated with 1 mM PBS/EDTA (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells (8 × 104) were seeded on fibronectin (bovine, 0.1 mg/mL) coated Millicell EZ SLIDE 8-Well (Merck) in 300 µL media/well (RPMI + 10% FCS + 1% ultraglutamine + 1% Pen/Strep + 1% HEPES + 1% Na-pyruvate + 1% MEM NEAA + 0.1% mercaptoethanol).
-
bioRxiv - Physiology 2023Quote: ... phloretin (50 mg/L; n=8) or ritonavir (60 mg/L; n=8) (all from Merck, Darmstadt, Germany) in 20 mL of 2.3 % glucose peritoneal dialysis fluid (Balance ...
-
bioRxiv - Biophysics 2021Quote: ... Immuno-identification of the samples was done using α-c-Myc rabbit antibody and followed by a secondary HRP-conjugated α-rabbit antibody (Merck). α-Histone H3 rabbit antibody was used as housekeeping protein ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Bioengineering 2023Quote: ... 8 μg/mL Calcein AM (Merck, Germany), 4 μg/mL PI (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.001% phenol red (Merck, 143-74-8), pH 7.8) ...
-
bioRxiv - Cell Biology 2020Quote: ... Active-β-catenin (Merck, Cat. no. 05-665-25UG), α-tubulin (Proteintech ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.4% (v/v) β-mercaptoethanol (Merck Sharp & Dohme BV) and 0.1% hydrocortisone (H0888 ...
-
bioRxiv - Neuroscience 2021Quote: ... or mouse monoclonal anti-β-actin antibody (A5316, Merck) diluted in TBST ...
-
bioRxiv - Plant Biology 2020Quote: ... autoclaved) with 1% β-Mercaptoethanol (Cat No.: M3148, Merck) and 100 μL of Ambion Plant RNA Isolation Aid (Cat No. ...
-
bioRxiv - Immunology 2022Quote: ... Mouse anti-β-actin mAbs (Merck Millipore, Darmstadt, Germany). Horseradish peroxidase (HRP)-conjugated goat anti-mouse Abs (Abcam Biotechnology) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 nM β-estradiol (Merck Millipore, Cat#3301) to shuttle C/EBPα into the cell nucleus ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 nM β-estradiol (Merck Millipore, Cat#3301) to shuttle C/EBPα into the nucleus.
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-dopamine β-hydroxylase (DBH, 1:1000, Merck) was used to visualize LC neurons and rabbit anti-red fluorescent protein to visualise the fRed tag (tRFP ...
-
bioRxiv - Genetics 2023Quote: ... and supplemented with 0.8 mg/mL β-sitosterol (Merck). Cultivation and autogamy were carried out at 27°C as described (Beisson et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-β-actin clone C4 (Merck, #MAB1501, 1:1000) and anti-Tpm-4.2 (Suchowerska et al,22 1:1000) ...
-
bioRxiv - Biophysics 2024Quote: The insulin-releasing pancreatic β-cell line (1.1B4, Merck KGaA ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit α-Tenascin C (Merck Millipore Cat. No. AB19013) 1:150 ...
-
bioRxiv - Cell Biology 2021Quote: ... α-tocopherol (catalogue Number: 258024) were purchased from Merck Life Science Sp ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-tubulin α mouse monoclonal antibody (Merck Chemicals GmbH), and anti-p230 mouse monoclonal antibody (BD Biosciences) ...
-
bioRxiv - Plant Biology 2021Quote: ... and α-rabbit-HRP (A-0545, Merck; 1:10000).
-
bioRxiv - Plant Biology 2021Quote: ... and α-rabbit-HRP (A-0545, Merck; 1:10000). Western blots were imaged with a LAS 4000 IMAGEQUANT SYSTEM (GE Healthcare ...
-
bioRxiv - Biophysics 2021Quote: anti-α-tubulin IgG mouse monoclonal antibody (T5168, Merck), dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-α-Tubulin mouse antibody (1:1000, T5168; Merck), anti-SARS-CoV-2 Spike glycoprotein rabbit antibody (1:300 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-α-tubulin IgG mouse monoclonal antibody (T5168, Merck); mouse anti-tau (Tau13) ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-α-tubulin (Merck, 1:1000, TAT-1 00020911), anti-GFP (ChromoTek ...
-
bioRxiv - Immunology 2023Quote: ... IFN-α (100 U/ml; Merck, Rahway, NJ, USA), BAFF (20 ng/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-α-Tubulin mouse monoclonal (DM1A) antibodies (#T6199) (Merck); anti-DAPK3 polyclonal antibodies (#PA5-90193 ...
-
bioRxiv - Neuroscience 2023Quote: ... and donkey-α-chicken Cy3 (1:500, AP194C, Merck) in blocking solution for 2 h at RT.